Description :
From Genome Similarity Track
Location :
scaffold_436:18872- 23772
Transcript NameFunction/comments
Pl_104878hypothetical protein PHYSODRAFT_462099
Pl_104879conserved hypothetical protein
Pl_104880hypothetical protein PHYSODRAFT_483739

Sequence
4900 bases(100 bases per row)
GCACGCGATGAAACTTGTTTGTATCCTGCTGTTTAATCATCGTCTCCCAACTAAGCAGTTGGAGTTGCAATTCTGTCGATGATACATCTCCAGTGGTGGC
AGGAAGATTGCCTTCTTGCTTTCCACACGACAACGAATGATCATGCTTGTCGTTTAACGACGCTAAGAAGAACCGGAAAATGCCGTCCGAGTCTGCCATC
TCCAATAATTTGGCGCTTAGGATACTGTCGATAGTGTACTTGGCAAACACATTTCCTTCCTCTTGCTCTTGCCCACTTCCACCTTCAACAGCAGATTCCA
TACTCCTGCGAGCATTAATCAAGTGCTTGTGCAGACGAACTGTGTCTGGCTGCTCTACGCTGCACAAACCAACACGCTCCGAACACATAGCACATGTCAA
CGACATCCACTCGTGCTCGTCCTTGTCATTATCTCCTGATGCAACGGCTGTCTCGTCCTCATGAGCCGTCGTTCCCGGTATCAAGTCGGTAGCGTGCAGC
AACACATACGACTCACCAACAAGCACACGATGCTGCTGTGCATGAATATCATCCCGTGGAATATGCTCAAAAGCTCCAATACCAGCTCCCCAGAAGTCAA
ACATATCCATCCAATTGGCCGATGGCAGCGGTAAAACCTTCTCAATTCGAGGGCTTTTTCCTCCGTCCAGTAACTGAGCCTTGCATCCTCGACAACTCAC
CGAAGCGTAACTCTCCGGTCGAAGCTCTACAGGTGAAACTTGCGTAAATGATGAGAACCCACCCAGTGGCTGTTTGTCGCTCGGTCGAATGGGGAGTCTC
AGATACCAGTGATCTTCCTTCTCTTCCACTGCACACTGCGAGACGTCCACGTTTCGTTCAATCTCCGTCCACCAGACAACTTCCTGCCTTATCTCGCTCT
TGTACGTGATCTCTACACGCGGGAATTCCACACAAACACTGAGCTTTGAAACGTCAAATGCCAGTGTCTTCCCTTGTCTATGACTGTCGAGGAAGAGATA
ACACTGGTAGCAGCCGATATTGGCGTGATATTCCACCAGAGAGTCCGAGATTCGAGGCACAAGAGTCTCTCCGTTGATGTGGAGACTGCGCAAAGCTTCC
GCTGTGCTGGATAGTTCCCTATCGCTCACCTCTTCCGTGTCGCCATTCTTGTCATGCTTGATCTCCATTGCTGTCTTGATGTGGATACATTTGTGTGGTC
AACAAGACGTACACAATAGTGTGGTGCACACGAGTGACCTAATGTGCGATACACTAATGTATCCATCTTGCTGTTGCTATGACGCACAGTTATTGCTGTT
CTTGTCGCCACGCTGACATCGGTGATCGTGCTGACGCCACTGAGGATGCCGATACCGATTTGCGTGCTACGACCGACAAGCTCGGAGAGTTTCAAAATCT
TGAGCCGAGACGTGAAGGCGTTGACATGAGCGGAAGCAGCTGCGTGGATGTTATGGAGATGCCAAGGGTTTCGGCAACGGTTTCCAAGTGTCAGGTGCAT
CTGGCCTCTATCAAGCGCGGATCAAGCGAAATTAAGTACACTGGCCAAGCACTGGATTCCATCTCGTCTTTGAAGTGTATTCGTGTTGCTTTGTTGAATA
GTTTCATATAGTTTCATGCTGCTTTGTTTAACGGAGCCGCTATCCAGTTGTAAAATTTCGAGGTGGGCGCAATTTTTTCTAGCTGAATGATTGGATACAA
AGTTCAACTTTCCAGAAAGTCGGCAATTTCCAAAACGTGCGTGTACTGTATAAGATATTGCGAACGTGAGAACGGAAAACCATCTGCACGACGACTTGTC
TGCAACGTGCAGCCACGTCTTCTTTCGCGATACACTGATTTCGACGATATCACATTTAATCCCTTTGAACGCGGCTTCCCGTCAGTGTACCATCTCCAAT
TATCCAGCTCGAAGCGTTTCCTCTGCTGTACTCACAAAACCGTTCGCCCCTTTTTCTATATCCTCCAGTTTCAGTTTCTCAATCGTGTGGTGCACACAGT
GGTACAAACGGGGGTAGGAACAACGACCAGCGATAGGCCAAAACTCGAGTCGTGGTATCGAACGAAACGGCTTGCGATCGTCGTCAAGTCAGCGCCACTT
CAGTCTGCCCCCTACTCGATCGATCGCAGAGACTCGAGGACTCCTCGCATGGCCTACCTGACCATGACGCCCGACGACATTCAGGGCGATTACACGTGCG
CTGTGAGCGTGGAAGACTATCGTCTCAGCAGCAAGAAGGCCGAGTACAAGGTCGTGGTGCAGCTCTCCTTCTACTCGTCTCGAGCTCATGCTACAGGTCG
CACGAGTTGGCACATTTGGCGCAGTTTCTCCGCCTTCCGCAAGCTCGATGAGCAGCTACGGAAACGTAGTGCAGCACTCATGAAAGGTGTCAAGTTCCCC
CCGCTCTATCGACGGAAAGCCTTGTTCCGTGCAGATAAAAGCCCCGAATTCTTAGGTGGTCGAGCCAGAGAACTGGACAATTACATGAACGTCGTGACGC
ACAAGCCGCAACTTGTGGCGTTCCATTTGGCAGCTGTGAGCAGTCAAACACTCAAGAGTTTCGTCGGATTCAACTCAGGCTTTGGTGCCAATGCAGACTA
CGACCAACAAGATGCCAATTTACGACCTTCATCGTCCATTTTGGCATCTCCTGCAGTGGTTCAAGCTACAGCAAGTGTCATGGGAGATGATGATGATGAT
TTCCGCTCCGTTTCCAGCAGTTCGACAGTCTCTTCCTTTGCTTCGACGGCCAGTGACTATCGTTGGTCCGGAACGGGCTTTGTAGGCAGTCAGAGCTTTG
CTAGACATACTGTACCTCAAGTACAGATGGGAGCTGGACGCTCGTCGTTCGCTAGTAGTCGAGGATCCTTTGCTAGTGTTGGTCCTGGATCTTCCAGGGG
AAGTTGGTTCCCGGCTTCATCGGCTGTGTCTGATACTGCTGGACGTGCATCCATGGCTTCTGTTTCGAGGGGATCCATGATGGCTATGACGGCACCTGAT
GTCATTACGCCGGAATTGGATATGCAACGTGCCAAGATGGAGGATCAACTAGTGCAGATGGGACTGGTTGGTGTTGGTATGCCACCGGATGGATCATGCT
TGCTGCACTGTATTGTGTATGAGATGTATCCGTTGCAATGTCTCCGGGACTATCCGGCTAGCATGACGGTGGTGAATGTTGGTGCGGCGGACGGCATGGC
GCCTCGACGAGTAGCAGCTGCGCAGTTTTTGAGAGTCAAATTGATGGAATACGCGCTAGAACACATTAAGAAACTTGCGGGCTTCTTGATGCAGGATGAG
GAAGATGTGCGGGAGCGATACGAGACTTTCAGAGACACCCCAGATGAGCAGGCAACGACCGCGGAGTTGTACACAGTGGCGAGCATGTTTAACATCGAGT
TGGTGCTGATTTCCAACGACGAGAGCTTCCAGATTGACCCCGTGCTACCGATAGACGGGCTTCCGTCAGTACGTGAAGGCCCGCGACGCACCGTCACATT
GGGCTACTTGATTCCGGCAGATGGACTTGCCGGACACTACATCTGCACGCGCGAACGGCGTGCGCAAATTGGCATGCCTCAGAACAGTTTTGCTGGAGGC
AGCTACCGCGGATCTATCCACATCGGACCTCCTAAGAATATGAGCTGTGGCGCCTCGAATAACAGGCGCTTCGAGCGGATCCCGGAGCAGCGAGTTGAAT
AGAGTCCCTGTGGACAGCGATGACGGATAGAAGTACAAACAACAGATCAAACAAACCAGCACAAACATCAAAAGTAAGCGACGACGACGACAACACAGCG
AAAATGACATAACCCTCCAGCCTCGACAACAAGTCGAATGGACCAAGCACGGCGGAGAAGTCCACGTACAAACGAAATTCCCAAAATCAGCACCGGATGC
GAGCGGCCTGAAAAATCAATACCACGGGCGTAGTAGCTGGCTCAACGAGTGTGTAAACTATCGGGCTGCGTTTTGCAACTTGATACTCGACAAGTTGCTC
AGCTTCCTCTACAGCACTACATCAGCAAGTAAACCAACAGCAAATGGAACTGCATGGACGAAGTGCTATAATTTAGTGTTACAGAGTGTAGGCAATGGCA
ACGAGTCGAAGATCAACAGACAGCGGGCTTCTCTCGATCAGCGATGAAAATATATGTACGTGAGATTCGCCGGCCTCGGGCCGTTGGTGTACTGTACACT
TGTACGCGTGGGTGATATTTGAGCGGTTTGTCTTAGCGGATAACAGCGGTCGACAGGCTGAATCGGTTGCCTGATCGATCGATTCGAGAAGCGCACGGCG
ATACCGACGCCTGGAACACATTCCAGAACCGCAGCGTTTCGTCAGCTCCGGCCGAGGCCACGTTAGAGCCACTTGGAGATATTGCGAGGTGTAAGACTCG
TGCAGTATGCCCCGTGAGCTGGCGAGCCTGTTTCATCATTGGATACCTCCACAGTGTGAGCTGATTGCTTGCGGAACAATGTCCGTGAGCTGACACCAGC
TCTTGCGTTGTGGTAGACCAGACCAATGCGCACACCTGTGATCCTGCGTCCACAGAACGCAGCATTTGGCCATTCGACGTGCTCCAGAGTTTGATCGTGC
TGTCCGCAGTCCCTCCGCCCGATGCCAAGATATTTCGTTCACATGGACTCCATGCAAGGGCCCGCACAGCAGCGCAATGTTCGAGATGAGCCGATCGTGG
AGAAGAGATGTTATTCAACCGATTCACCCGTGTCAATACATGGTCCCAGAGACACAAATACTTGTCACTGCCACCGGACGCCAACGTGCTGCCATCAGGA
GACCACATCAAACCGCAGACTTCCCCGCTGTGGTGTGCGAATTTACCCACGAGATGTTGAGTGCAGCGGACATCGCTCAGATGGATCGTAGAGTCTCGAG