Description :
From Genome Similarity Track
Location :
Scaffold_9:188717- 191050
Transcript NameFunction/comments
Hyaar_Emoy2801771hypothetical protein
Hyaar_Emoy2801772PREDICTED: uncharacterized protein LOC101313541

Sequence
2333 bases(100 bases per row)
AGAGGAAGATTTTAATACAAGGTAAAGGTAAAAAAGTAGAACTGTATTCAGTAAAGTTAATTTCCTGTTAATAAATCCTATTTAGTCTTCTTTTAAATAT
GCCTAAATACAAACATGTATTGTACTAATCTGCCCATAACTCAATGCGTTCTTCCGTCGTGGCTCTGCTTTATTGGCTAATATCAATGCCCTACATCAAT
CGATGAATAGTCTATGACTTCTATATTAAGATAGGGGAGCAAGCTCTGGAGCTCGCCCTTTGATATAAGTAATCCAGTTTGGAGAACTGAATCAAGTTGC
AAAACACTATACAACAGCAGCAGTCACTGAAGAAGGATTATGATGATGTTAATGTCTAAATTAACCCAGAAGTATGCTCATGCAACGCGATCAGCCTTTG
TTTATGAGCATCCAGCGTTTTCTTGCATGATAATATTATCGTTTGATCGATTTTGAGCCAATCATGTGCGTGTGTCACAATACTTACCTAGCCAAAGAGT
GACTTTGTTTATACCTATATACCTATAAGAAGGGGACAGGCTTGATCGCTCTTAGTACGTGTAAGGTACACCTAACCGCGTTATTTACAGACACACAGGG
ACACAGATAAGTACGATTTAAAAAGTTCGGCTACCAGCTTGTGCACAGTCACTAATAGCTTCGCCCTTCGGGCTCGCAACTAAATTACATATCAAGATAA
TATTGTACAAATATGACGTCTTAAACAAACATAATTGCGAGCCCGAAGTGTGAGGCTATAAGTGAGTATGCGCAAGCTGGTAGCCAAACTTTTAAATCGT
ACTTATCTGTCGGTCTATCTGTCTGTCTGTGTGTGTCTGTCAAAAACGCGGCTAGGTGTACCTCGGACGCACTAAGTACATTCGAGTGTATCCCCCTCTT
ATAGGTTTATAGGCATATTCAAGTCACTCGTTGGCTAGGTCAATATTGTGATGCACGCACGCACGTGATTGGCTTATGATCTATCAAAGGTGAATATGAT
CACATAGTCAAACCCTAGACGCTCATAATCAAAGGCTGATCGCGTCGCCCTACTTTACTGTACTGGGTAAATACATACATTAGCAACATCTTACTCCTTC
TTCAGTCTCTGCCGCTGTATAGTGTTTTGCAACTTGGTTCAGTTCTGCAAACTGAATTACGTATTGCGAGCCCGACGGGTGAAGCTATTAGTGAGTGTGC
GCAAGGTTATATGCCGAAATTTTAAATCTTACTTATCTGTGTGTGTCTGTCTGTGTGTGTGTCTGTTATGGATCCGTTTGGATTTCTATCAATTCAAACT
AAAACGTTTTCAAACGTTTTAAAATACAAGCGAAATTAAACCAAACGTTTTTATTTGGGAAATAAGGACGGGGGCCGGGACGGCGTTAACTGCTCATTCT
TCAATTATCATCGACCTGGTTGTTGCTGAGCAAAAGGAAGCAGATCGACAGGGTCGATGTCGCCTTCCAAATCGTCTGCTCCACCATCGCCGTGCTGGCG
TCGCACCGCAAGTAACAGCTCCTTATCAATCAGGCCAGTGTCGACCTGGGCAGCTCTGTTCCGCAGAGCGGCGATGAGGTTTTCGAAGGACTGACGCTTC
GGAGGCAGGACACGCCGCGAAGTCGCGCTGTTGTACGCCACCGCAACTTGACGTTTGACCTTGCTGCTTCCAGTACGGTTGTGCACCGATGTACGGACTC
GCTTGCTAGTCTTGTGTTGGCGCTCGACGCCGGCTGATGAACCCGTCCCGCAATACATACGGCCGAGAACCAAAGTGAGCAGGGGCCAGCGCTCCCCGAT
CTGAGACCAAATTATGCGCGGCTGGTACGTGCTTATCGCTACTTTCTCCTTGAACACGGCCTCCTGATGCACGCAGAAGTCGAGGAACTGGCAGAGGAGT
TCAGCGCCGTCCAGGTCATCGTGCCGACGGGCCATCAGGGCGAGGGCCGTATGACACTGCACCCGCAGGTTGCCCATGCCAAGCTCGACGAAGAGCGCCC
CGTAGTGGTGCGTCAAATTCAGGCGCAACTTCGAGTAGAAAGGGTTGCGGAAGAACGCCGACGCGTAGACCGGACTATATACGAGCTTCCAGCGGTAGAG
CAGGCTCTGGATGGCATGCTCGCGCTGACCGTCGTATTCGGAAATAACACCATTCAGGTGGTCCAGAATGTAGAGGAAGCGTGCGTAGGCGGTCCCCATT
GCCGCCGAGTCGGACTCCAGCACACTGATGCACTTGCAAAGCGGGTCGAACAGGTCGGCGGAGAGGGCGACGCCTTCCCAGAACAGATCGGCTTGCATGA
TCTCAGCAACGGCGGGGGCAGCGAGAACGACGG