Description :
From Genome Similarity Track
Location :
contig_63:188702- 190242
Transcript NameFunction/comments
g11150.t1hypothetical protein

Sequence
1540 bases(100 bases per row)
TGCGAGGAGCTACGAAAGGGGGGGAGGGATTCGGTAAAACCGGTGCGCATCCTGCTGATTCGCCAGGACCATTTTCAACCGCGCTGATTCGCAGAGTACC
AATACCAGTGAAGTACCGGTACGCACGTTATCTATTCCATGTGGGCCACAATAATAATGCACAATTGTTGATACCGGTGAATAAAAGGCTTACTTTTTCT
ATTTCGGATGCGCTACCGGTGCGGGAACCCTATTCCCGGTATTGCGTGGACCAAAACTGCGCCGAGCGACTTGACGAAGCCCAGTAGGGAGAGCACCAGC
ATGACGCCGGCGCACGCGCTCCAGCTTGATGCGGCGCCCGAGGCCAGCGACTTTTTCTTCGGGAATGTGCTGGGCCAGGGATCGTACGCCAAGGTGAGCC
GTGTTATAGCCGCCGCCGCTGCTGCTGCGTGGGCTATTGCTGACTTCGTGCCCGGCGGTTTGTCGCTCTCGCTGCCTGTTGGCGCCGCTTGCAGGTTTTT
CACGCGCAGATGAAGAAGAATCACATGGACTTCGCCGTGAAGGTGATGGACCAGAGCTTCATCCGCAAGGAGAATAAGACAGCGTTCGTGCTCACGGAGC
GCAAGGTCATGTCGCGCCTCTCGCACCCGAACATCGTCAAGTTCTACTGCAGCTTCCGCGTAAGGCGTCTGCACTCTGGATGCATTTACTGCGCATGGCC
TCAAAGATGTTGAAGCCAAGGGCAGTGCAGCACCGCAACCGCAATCCATCTGGTCTCCTCGTCTCATTTTTTGCGTCCAATTGTGGGTACAGGACCACCA
CAGCTTGTACTTGGTGATGGAGCTATGTCGCGGCGGCGATCTCTTCGGAGTCATCAGGTGCGCGCAGCCTGTTCATTGTTCATGCCGGGAATACGAGGGT
GCTCATTGCAGTGCGTTGTGACCAGCAAGGAGTATCAGAACCAGCAGGAACAAGGCGTTTCGGACGCTGCGTGCTCTTTCGAACTGACGCAATTCTACAT
GGCAGAGCTAGTCAACGCGTTGGAATATATGCACTCCCAGGTACTGCGTCAGCAAAGAAGTCGTTGTTGTGATTGTATGCGATACTAATGAAGGAGAATC
CTGCTGCAGCATGTTATCCACCGCGACATCAAACCCGACAACTTGCTTCTTAGGTACGGTGCACTTTGAATTGAAGACAGCTACAGCCTCTGCATCGTAA
ATCCTAACGACTTCTTGTGCGGTCCCGTTCAGTGAGGATGGACACTTGAAGGTGACTGATTTCGGCACGGCAAAGGTAAGGCGCCCTATTCAGTGAGCTT
TTCTTCATGAAAATCGCGTTGATGTATTCGTTCTAAACGCTAGTGTTGGCAATACAGGACCAAGATGGCGAAAGTAGCGATGCGTGTCAGTTTTGTGGCA
CTGCCTCCTACGTGTCACCAGAAGTATTGCACGACAAGCCGGCTTCGCGAGGGGCCGATCTCTGGGCAATGGGTTGCTTAATCTTTCAGGTGCGTGCACG
GCCAGTGTCGAGTCCCAATGTTCTAGGTGCACTGATCCCT