Description :
From Genome Similarity Track
Location :
contig_63:188700- 190240
Transcript NameFunction/comments
g11669.t1RAW36969.1 hypothetical protein PC110_g6750 [Phytophthora cactorum

Sequence
1540 bases(100 bases per row)
GCTACGAAAGGGGGGGAGGGATTCGGTAAAACCGGTGCGCATCCTGCTGATTCGCCAGGACCATTTTCAACCGCGCTGATTCGCAGAGTACCAATACCAG
TGAAGTACCGGTACGCACGTTATCTATTCCATGTGGGCCACAATAATAATGCACAATTGTTGATACCGGTGAATAAAAGGCTTACTTTTTCTATTTCGGA
TGCGCTACCGGTGCGGGAACCCTATTCCCGGTATTGCGTGGACCAAAACTGCGCCGAGCGACTTGACGAAGCCCAGTAGGGAGAGCACCAGCATGACGCC
GGCGCACGCGCTCCAGCTTGATGCGGCGCCCGAGGCCAGCGACTTTTTCTTCGGGAATGTGCTGGGCCAGGGATCGTACGCCAAGGTGAGCCGTGTTATA
GCCGCCGCTGCTGCTGCTGCGTGGGCTATTGCTGACTTCGTGCCCGGCGGTTTGTCGCTCTCGCTGCCTGTTGGCGCCGCTTGCAGGTTTTTCACGCGCA
GATGAAGAAGAATCACATGGACTTCGCCGTGAAGGTGATGGACCAGAGCTTCATCCGCAAGGAGAATAAGACAGCGTTCGTGCTCACGGAGCGCAAGGTC
ATGTCGCGCCTCTCGCACCCGAACATCGTCAAGTTCTACTGCAGCTTCCGCGTAAGGCGTCTGCACTCTGGATGCATTTACTGCGCATGGCCTCAAAGAT
GTTGAAGCCAAGGGCAGTGCAGCACCGCAACCGCAATCCATCTGGTCTCCTCGTCTCATTTTTTGCGTCCAATTGTGGGTACAGGACCACCACAGCTTGT
ACTTGGTGATGGAGCTATGTCGCGGCGGCGATCTCTTCGGAGTCATCAGGTGCGCGCAGCCTGTTCATTGTTCATGCCGGGAATACGAGGGTGCTCATTG
CAGTGCGTTGTGACCAGCAAGGAGTATCAGAACCAGCAGGAACAAGGCGTTTCGGACGCTGCGTGCTCTTTCGAACTGACGCAATTCTACATGGCAGAGC
TAGTCAACGCGTTGGAATATATGCACTCCCAGGTACTGCGTCAGCAAAGAAGTCGTTGTTGTGATTGTATGCGATACTAATGAAGGAGAATCCTGCTGCA
GCATGTTATCCACCGCGACATCAAACCCGACAACTTGCTTCTTAGGTACGGTGCACTTTGAATTGAAGACAGCTACAGCCTCTGCATCGTAAATCCTAAC
GACTTCTTGTGCGGTCCCGTTCAGTGAGGATGGACACTTGAAGGTGACTGATTTCGGCACGGCAAAGGTAAGGCGCCCTATTCAGTGAGCTTTTCTTCAT
GAAAATCGCGTTGATGTATTCGTTCTAAACGCTAGTGTTGGCAATACAGGACCAAGATGGCGAAAGTAGCGATGCGTGTCAGTTTTGTGGCACTGCCTCC
TACGTGTCACCAGAAGTATTGCACGACAAGCCGGCTTCGCGAGGGGCCGATCTCTGGGCAATGGGTTGCTTAATCTTTCAGGTGCGTGCACGGCCAGTGT
CGAGTCCCAATGTTCTAGGTGCACTGATCCCTTTTGACCG