Description :
From Genome Similarity Track
Location :
Scaffold_104:188674- 196053
Transcript NameFunction/comments
Physo_141874reverse transcriptase
Physo_141875hypothetical protein

Sequence
7379 bases(100 bases per row)
GTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAGGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTT
TGTATACTCCTGCTTCCTCTGATAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACC
TGAATCCTCTGTGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGTACGAGTCCGTTCGTAAGATGGCAGGCAT
CTTTGGGACAGATGCCCTGCGTAGCTCAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGCC
CAGGTTCAAGGGCTGCAGGACACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAAA
ACCTTCACTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGG
TCGCGCTAAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGCACCGCGTTTCTTCCG
GCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCCT
CTTCGGTGGGGAACCCCCTGCCTGAGCACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAGC
AAACACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCAACGTTATGGCAGAGCAACCCTGCCTCT
GGCGGTGCGCCTAATGGTAACTCAGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGCT
GTGGCAAGCTTGGGCACATGAAACGTGCCTGTCCCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCC
GGGCCCCAGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAGGTCTTCATGAGGGGCGTGCGGGTGGCGCACGCC
ATGGGGACTTAGCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTGCTTGTGGTACACGCAAGTGTACCGGGATACGATCATCCC
TTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGCA
AAGGCAACGGGCTGGTCTCGGTAAGACTGGTCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACAG
CATGGAGCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGTATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCAAG
GCCATCGGGGCCAGCCGTCCTCCACGCTCGGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGCAGCCGGGGCGCCCGCGAGGGCCGCCAGGGCG
CAGCAGCGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCA
GGTGGGTAACGTAGGCCCACACGCGGGTAACGAAGTATCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTGGGTAACCAAGTTCCA
CGCGAGATCACTCAGACCGTAACTGATGAGGAAGGCACTGCTGGCGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAACTGATG
CGGGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCT
CAAGAACAAGGCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGACGAAGACACCCGAGGGTCACGTCGT
AAGCCGGGCCTAGTCGTGTGGCCGACGACGCTAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACG
GCGTGACCGGTAGTCGGGTCAGAACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGATGAGCTCGCCATGGAGGACTT
CTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCAACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGACCAGGCA
GTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCACATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGGAGTTTGAGG
ACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGTGTCACGAGGCA
ATGGCCTCTTCCCCGGGATCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCATGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACG
CCTACCTTTTGTGGTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAATGCCTGCGCAGACACCGATCCCGC
GCAAGGACGTGTTGCATGGCCGGCTGAACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTACCAGAGCCTGATGCGCGAGAGCGACATCCCACTCA
CGGCTGTTAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACT
CTTCCGACCTTTGCGTGCGTTCACACAGACTTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAG
CACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAATGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCT
TCGTCAGCAGCGCCGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTAGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGAG
CCTCGCCAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGT
CGCCATCAAGATGGTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATG
CGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAAGGCAGCCGAACG
GAACTATTCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACGCCCTTCGTCGTTTATACA
GACCACGCGTCCTTGCGGACTGCCGCCGTCAACACGCCACATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAATACAACTTCCGTGTCG
AGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGA
TCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGGCCGCTGGCTCGGAGGCCAAGGCCGAGTGGCTCACGCCCCGA
CAACGTGCAAGGCTGCACCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGG
ATCTCAAGTACGACATCCTGATGGAGGCGTATGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTG
GCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTG
CCGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACATTGTCTTCGGACTTTCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCC
GTCTGAGCAAGATGATCCACTTTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCACCTGTTCATGGACTGTGTCTTCCGACACCACGGTCT
GCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGCTGTCGACGGCG
GACCACCCGCCGACGGATGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATC
GCTTGCCTATGGTTGAGTTCGCACTCATCAATGCGGTACATGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCT
CACATCACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCGG
AAGCAACTCTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACC
GAAATGGAAGATGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAA
CAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGTCGGCATGGCGCGGCGTACACCATAGACTCGATGACGACTCACCCGACGTTTTACGTG
GGTCGTCTTAAGAGGTATCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCTTCGAAGCGCGGCGT
CGAGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGCATACGCAGGGGTCCCGTACGAGCCCTGGCCAAAC
TGGGCCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCGTAAG
ACGACAGGTCGGCTTGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCATGGAGCCGCTCCACGGCACCAGGCTG
ACCAGCACGAGCGGCAGCCTCGCCACCAAGGCTGACGCCAAGCGCGGTCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTTGCTGCAGG
GCCACCACCTGACTCGGGGCCCCACCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGTCCTCCTTGATCGTAATGGG
CAGATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCATGAAGTGGACTGAGTCGGATAACTCGTGGGAGC
CCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCATCGGCAGCTTCGTAAGTTGTCCTTGGCTTCTTGGTCGGTACC
CGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATCTTCGAGTGGAGCTTGG
ACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCACTAAGGCCACGAGGAGCCGAAA
GCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGT
GGCAGTCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCA
CCCTCCTCGTCCTCAGACTACGAGTCGATAAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCT
TCGCAGCGGCAGCCGCTTTCGACACTTGGGAACGCTCACGACCTTGTGCCAGCGTCAGATGCTTCGATGCCAGCACTTCCTTGGGCTTGGAGCCCGCGTC
GCTCGCCGACTTCTCGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCGCCTCC
TTCTCTGACGAAGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCT
CGTCGTCGGGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTC
CTCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACGACCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCC
TTCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGGAGGTGCTTTCGCACTGCGCG
CACTGCGCTTTGGAGGCATGTTTCCAGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAG