Description :
From Genome Similarity Track
Location :
Scaffold_188:18867- 22079
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_188-snap-gene-0.23Rab11 family GTPase

Sequence
3212 bases(100 bases per row)
TCCTCGGCTATCTACGGTCTGCGCGGCAAGGAGAACGTCGACGTGTACATTCTGTTCCCGCAGGGTCGCGTGAGCGCCATCCAGCAGCGGCAGATGACCA
CCGTGCTGGACGCCAACATCCACAACGTGGCCGTCAAGGGCACGTTCGACGACTGCCAGGCCATCGTCAAGGATCTGTTCGCGGACGCGCAGTTCAAGGC
GCAGCACAACCTTGGTGCTGTCAACTCGATCAACTTTGCGCGTATCCTGGCGCAGATCGTCTACTACGTGTACGCCTACTTCCGCGCCAAGGAGGCCGGC
GTCGAGGACGTGTCGTTCTCGGTTCCCACTGGCAACTTCGGCGACATCCTCGCGGGCTTCTACGCCAAGAAGCTCGGTGTCCCGCTCGGCAAGCTGGTGG
TCGCCACCAACGAGAACGACATCCTGCACCGGTTCTTCTCCACGGGCAAGTACCACCGCCACGCGATCGAGCACACGTCGTCGCCCTCGATGGACATTTG
CGTCTCGAGCAACTTCGAGCGGTACCTGTTCGCACTGAGCGGCGAGGACCACGAGGCGCTCCGCGGCTGGATGCTCGACTTTGAGAAGACGGGACAGCTG
ACGATCGAGGGCGAGCTGCTCGCCAAGGCTCAGGCCGACATGGCGTCCTTCTCGGTGCGCCAGCCCGAGGTCGACCGCACGATCGCCGAGTACAAGAAGG
TGCACAACTACCTGTTCGACCCACACAGCGCGATTGGTGCCGCCGCCGCTGCGCGGTATGGTGAGAAGCACCTCTCTGGCAACCCGAAGGACGCTGTTGT
GGTGGTTGGCACGGCTCACTACGGCAAGTTCCTGCCTGTGGTGTCCAAGGCACTGGGCGTGTCGGAGCAGGACGTGGAGCAGCACCCGAAGCTCAAGGCG
CTCGAGACGCTGCCGACCCGTCTGGCTGTTGCCGACAACTCGAAGAGCGTTGTCGCCGCGCTCATCAGTGGCAAGGCCGTGAAGAAGACGACTACCAAGA
CGGTCAAGGTTGGCGGCTCGCCTTCCAAGAAGCCTGCCGCGACTTGCCCGATCCCGTTCCACGGCTCGGGCATGTTCGTGACGGCCTCGCTCGTGGTCGC
CGGTGCCGCGGCCGTCGTGTTCTTCGTGCTGAAGCGCCAGAACCACCACTAGAGGGCGACTTTGCGTGTAGAGAAGCTGTCGCACACACACACACACACC
ACGGCGTTCAGTCAGGCGCGAGAGAGCGGGATAAACGAACATGAATGCACCTTGTACTAGACAACACCCACAAGATACCAGTCTACTATGTGTCAATGCA
TTGCGAGCTGCCAGCGTCGCTGGCACGCAACGCCAGTTTGAGCGAGCAGAGGTTCGCTCCTCTAGATCACAGATATGAGCCGCTTTAAGTCGAGTTGATC
GGCTCGCCAGTTTGAAATTCCCGCTCGCCGCGGCACTTTATATACGTTGGGTAATTAGCAAAGGCGCCGGCCTCGTGGCTGTCGGGGTGTCCGTCCCCCA
TGCGCCGCTAGAGGATGCAGCACTGGATGCCCGCGCAGACGCCGCACTGCGAGCCCTGCTGCTGCGCCAGGAACGCCTTCTGGTGTTGCAGCTGCAGCGT
CTCGCGCGTGACAGTTACCCGCGCCGGGACACCGCTCGAGCCGACGGGGCCGGAAGCGCGGAAGCTGTACTGCGACGGCTTGGCCGGTTCTTTCGGAGCG
AACGAGATCCGCTCCTTGGTGTACTGGTTCTCGTACGAGTATTCCCCCGGTCTGCCAGTCACAGCGAGTTAGACTCTACCCACCGCTCGATAAACGAACA
GCAGCGCGTACCGTGTCCTTGACAGCACGCGTCGCCAGCCGGGAGGCAGCTTGGCGATCTTGGTCTGGCTCGGTCCGCTCGGCGAGAGCAGACGACCCAC
GGGAACGATCAGCTTCTTGAAGGCGTCGACCACGTTGGTCGCGTCGAGCGCCGACGTCTCGAGGAACTCCATCGAGTGCTTGGCCGCGAAGCGCGCGGCC
TCGAGCGTCGACACCTCGCGGGTCTGCGGCTGGTGCGCCAGGTCGCACTTGTTGCCGACCAGGATGAGCACGAGGTTCTCGTGCGCGTGCTCGTGCACTT
GGGCCAGCCACCCCGTCACGTTCTCGAACGAGCTGCGGTTCGTGATGTCGTACACGATCATGGCGCCAACGGCGTTCCGGTAGTAGGCCGCCGTGAGCGA
CTGGAAGCGCTCCTGGCCGGCCGTGTCCCAGATCTGCGCCTTGATGCGGCGGTCGCCCACGCGGATCGTCTTGGTCGCGAACTCAAAACCTGCCACACAC
ACACAAAGCGTTAGACCGCGACTTCACACTCACCCACTGGCAGCCTCCGTCGACATACCGACGGTCTGGACGCTGTTCGGGTGGTACTTGTTCTTGGTGA
AGCGCATGACGAGGTTGGACTTGCCGACGCCCGAGTCCCCGATCAGCACGACCTTGAGCATGTACTGCTGCGCCGTCGGCGTCCCTCCCGGCGACGAGCA
CCGCGGACTGCTGGTCGCCGACATGGACCCGCCGGCGTGCACGTGGCCGCCTCCAGCGCCGCCGCCCATCGGACTGTCGAGTCCGCGGCCGTCCTGCGCG
TCGAACAGACCGGAGCTGTTGGAGCGCCGCATGTCCCCGCCGCCGTGGCGCAGGATCCGCTGCTGCGCCACCTGCTTGGCCGTCATGTATGCCTGCAGCG
GGTTCCCGATCGCCGGCTTCTGAGGAGGATCGCCGGCGGAACTTCCCGTTGGGAGGCCCGGCGGCAGCGCCGTTCCGTGCTGCGCCATGCTGCGAGCGGC
TCGCGTCTTCCGTTTGTCTACCGGGACCGCGGGAGAAGCGATCGCTTCACCAGTGCTTCCAATCTCCCCCGCCCGCGACGTCGGCGAGATCCTCGGCCGC
CTGATTCCTTCACTCCGAGCCCTGGCAGGTGCGAGGTCACGGCGGAACAGGATGCGCGCCGAGCGTGGACTTGGACGGCCCCCGCCCCCGCCTGATTCGC
ACGGTACGGTACGCGACGAGGATCGAGACGGCGCCTGTGGGCTGGTCTCTTCCGCCGTCCGTCCGTCGAGCGGCACCGAGAGAAGGCGAGCTTGAAGCGC
AGGCGGAACGTTCGGCGCGACACCGGCGCGCTGGTTCTCGAGGCAAAGTACTCTGTGCGCTCGGTTAGATGCGAACATGAGGTGATGTGATCGCCTTGGT
ACTGCAGGCGAC