Description :
From Genome Similarity Track
Location :
Scaffold_34:18865- 20207
Transcript NameFunction/comments
Phyra_78701poly [ADP-ribose] polymerase, putative

Sequence
1342 bases(100 bases per row)
AAGTACGGGATCTCACCGTGCGGTGTCACACGCACAGCGTGGCGGTTGCCCGGCAAGTAATCGAACGTAGCGTAATGAACCGTCGAGCGGTTGTCCCAGA
TAGCCACCGAGTTCTTCGTCCAGTGAAAGCGGACCTGGAATTCGTGCCCTTCCGCAATGTGCTTGTAAAGGAACCGCAATACCGCGTCTGTAGAATGAAA
GTACAAACAGGTTGCTATACTCAGTACCCTTCACAAGCATCCTGTGGTGGGGGCCAAACACGTACCAGACTCAGCAGCAGACAGGTTCTTGATGCGCTTC
GTGAACCCGGCATTCACGAACAGAGCCTTCCGCTTCGTCACAGGATGAGTGCGCACGACAGGGTGCTCGAATTCGACCACCGGCCGGCGAACGATACGTC
CAGCCTTAATTGCATGTTCGGCTTGGCTCTGTAGATAACATACACAGTCAGTGAGGTTTAGTTTTCTGTGTGTGATTTTTGTTTTGTTTTTTACAGCAGC
GAGCTGCCGTACCTTGCCACTGTGCAGCGCAACCAACCCTTCCACAAACTTTTGAAACGCTGGGGTGAGGCGATTGTATGCTTCGTAACCGCAGGCCCAG
AGCGTGTCACCGCCCACATCGGGGCTTGTCAGGACTTTGAAGAGCGTGTACGATGGCGGCTACAACAGAAAGCAAATGAATTAGTAAGCGATGGTTTCCT
TAGCGATTCGCACTGCGCCACATTACCTGGCGCTCGTAAGACACGTCCGTGTGCCAAGAGCTCACTGGGTCATAGTAGTGGTGCTTGAGCACCTTGTCGC
TTGTCTCCACAGAGTTCTCCACAACTAGCATTTCGGGGTACTGCTCCGTGTGGGCTAAGTTCTGTTGGATGTGGAGAGGACCGTAATAGCGGCCAAGTTC
AAGCTGCTGCTCGGCCGTGATCTCCTGCTCGCGGAAGAACACCACGCCGCGCTGCGCCACCAGCAGCGCCAGCTCGTCCTTCTGCGCGTCCGTCAGCTCG
TGCAGCTGCAGACCCGAGATCTCCGTGCCAATCTTCGGCTCCAGGTGCGTCACCGTCGCATCCGCAAGCAGGTTCTTGAACGACGGGTCGGCCTAGAGCG
CGCGGTCGTTGTACGGCAGCACGGGGATCGGATCGTACGTCGTAGGAGGGAAGGTGCTCAGCAGCTCAGGGTGCTCGAACTTGGGGTGCTCGACCTCTTG
GTTGAGCGCGTTTTTCACAGGTACAGTGGCCTTCGAGGCAGAGGTCTGCTGGGCTTCGGCCTCTTGGTTCTGGGGTGCCATGGTGAGTGTTGATGTTGCG
CACGCGTCGACAATTGGAAATTGAGGTGGGGTCGTCCGGGGG