Description :
From Genome Similarity Track
Location :
Scaffold_873:1886- 4018
Transcript NameFunction/comments
Phymu_g12225hypothetical protein PHYSODRAFT_319813

Sequence
2132 bases(100 bases per row)
TCCATCTTCTGAGACTATCAGTGGCCGGCTGGCGCTAGTGCATCTACAGCAGTTTATAACAAGGATGCCAGACCTTCTGTTGCATGTAAATTTATCCCTT
CCATCGGCTCCATCCGGCACCGCCAGCGACTGTCCAAACGCTGGCAACACGCCAGTTGCAAGTCAAGTTCAGCAGCCAACGCCGAATTGCGGCACTCTCG
CAATAAATCGGATCACGCCGTTGTCTCAGGACCGTGTCAAAATTCCTCTATATTAGCATATTGTATCTCATTCGATAGGTTTAGCACGCGTAATCTGAGG
CTGCGTATCGCAGGTCGGAAATAGAACGCGCCTCTGCCTCTGACCTTGGGCTGGCGCCTGCGTCACGTGCTGTCATTCTCGAATTTGCTTCGACCAGCAC
ACCCCAATTACAACCAATCAGACACAGCCATGGCCTTTGAGAGCACTGTGGAGATCACGCGCGGCGGCGTGGAGACCAAACAAGGCGCCccgcagcagga
gacgccCGTCACCGAGACGGAGAGCGCCATGACCTTCGCCATTCCGGCCCCTATCGCCACTGTGCGCGCCAACATCGCCGCCTTCGAGGAGGACAGCATC
CGCAAGCTTCTGACCCGCTACGAGGGCTCGGACGTGCTGCCCAACGGCTGGCGTCAGGGACCCAGCAACAAGGGCATCCAGGTCGTCTACGGCGAAGTAG
CCGGCAAGGGCAGCGAGTGGTACACCATGAAGACGACTGGTACGCTTAACGTCAGTGCTGCCAAGGCGGCGAACATCCTCATGCGCTGCGACATGGTGCC
CAAGTTCGACGAGATGACCAAGGAGGTTAAGACTATGGAGAAGCTCAGTGAAGCATCCGAGGTCCGTCGCGTCACGGCCAAGTCTGTCATGTTCACGGCT
GCCCGCGACTTCTCCGTCGTTTCCACTTACCGTGAAGAAGCCAGTGGCCGCATCCTCATCGCCACGCGCTCAGTGGAGTTCGTGCCCGAACGCAAGGGCT
ACGTCCGTGCGACGATCCTGATTTCGGGATACGTGGTGACGCCTCACCCGACCAACCCCAACATGTGCGAGATGAGTGTTATTGCCCACATGGATCTGGG
CGGCAACTTGCCTGCTATGGTGGTGCGCTACCTCGGCTTGTCCGCGCCCATCAAGCTCGTTGAGAAGATCCACCAGATCACGCTCAAGGCATAGGCGGAT
TCAGCATGAGTAAATTTACCCACACAAAGTCAGATAGCATGTACCAGTAGTAAGCTAACCATTTAAGAACGTGGTTTTATCCCTCAACATTCCTCTTTTC
TTGGGGCTTCGTTCGCAGCCACTCGTGCTGGGCGCCTGGAAGCCTCCTCTTTACGCTGGGCGGAAGAAGCCGCTCAAGAGACTGAACAGAAGCGTGCAAC
GAAACCGGCCGCTCAACTCGCTCCAAAGAGTCTTGGACCAAGacgactcgaagctggcgctTGCTAGCCACAAGAATGGATGGGTCGTCTGCTTGAAGCA
TTTGCGCGCAATCGGTTTACTAAGTACTGGTACACTTTAGGGACGGTGGGATCATTTTCCGCGAAGCAAGTGCAATTGCCGAGTCCGTCGGTGACTGTGT
TGGCCCAAGCGGAGGACGAAGCATACCAAACGGCAGTGTGCTGACGACGAATGCCAGTGCCTACCTAGTCAAACTGTcaagacgacggagacggtCAACT
TGGCGGGTCAACCCAAGGCTACGGACTATCATACCGGTACGTGTTCTTGGAGATACGAAGAGCTCGTGTCGGAGGGCGAATCCTGAGCCAGGACACAGTA
ATGTGTGCAACTTTGCGGCGCTGACGTTCGACTTCCACTTAAACGCAGGTTTGCAGTATTTTCGTAAGGAACTGAGGATTACAAGAAGGACCCAAGCCGA
TTGGTTTCTTGAGTGTTGTGATGTGTCAATGCTGGCCAAGGCCTCAGCAGAAGCGTCAACGGACCTTCACGTCGAGTGTCTTACCGCAGGCTTAGTTTAG
TGCAGTCAGAAAACTGTCCTAAAACCATCGTGTAACATACCCTGCATTTGCCCTGCAACTTGGTAGATCTAAAAATTACGGTTTTCTTTAAATCCTTGTT
TGAATTAACAATTCAGTGTACCAGTAAAAAAA