Description :
From Genome Similarity Track
Location :
Scaffold_2029:1886- 3585
Sequence
1699 bases(100 bases per row)
TGTGCTCGCGATCGACGCTCTTGCTGGTGGTAGAAGTAGTTGTAGTTGAGCTGCATCACAATCTCCGTGACGTGGGGAGACGCGCCGTGCTTCTGCATGG
CCGTAAGCATAACTACCAAGAAATGAGACTGCCGCTTGAATTCTTTTGAGCTTCTCGTCATTTCAGCGTGAAGCACACGAAAGTCAGGACGGTCGAGTAG
ACGGGCGCTCAGCAACTTGTCACCGACTTGATCCATGGCCTGCTTGGACTCTGGGAAATATGTGTGCATATTCCGGTCAACTGTGCTGACGAACTCGTCA
ACTTGGCCAACAAAGCGCAAGATATGGTTGAAGGTCGTCAGGATGTACTGAATCACTGTCGCGTGCTGCATGATCAACACAGATCATGTGAGCACCTCCC
GTATTTTTGAATCCAGCGGTTAAATAAATGCGTTGTACCTTGTCCAGAAGAAAGAAGCGATTTAGCAAGTCATCAAGATACTGCTCGTGAGTAGCATCCA
TCTTCTCACATAAAGTGAACACCAGCACAAATGCATACACCAAGCAACCAAACGCTTAGCGAGAACCATCAAAGGGGCAGATATGTAAGGCTCATACCGC
ACCTCTCCTAAGCTTCGTGAAGATAGCATAACCTGGCGATATTTGGACCACCCTTGGCTTGATACCTGTGGCATCTCAGATATGTGAGCACACCAAAACC
ATGGAATATTCCACGTACAGACTTGTACCTGACTCGTGAGATAGCTCAGCAAGCTTTTTGTGAAATGCAGCATATCTGCCATTTGAACAAGTAGCTGACG
CATGTCTTGCTCAATGCTGAAGCATACAGAAAGAACCACGAAGTCAGCTTCAGCCACCGAAATACCAATTCGAGATACCGTTTACATACAACGAGTAGCA
TCTTCGATGTCGAAGAGTGGATTTGAACTGCAATGAGAAAGAACAGCTCGAGTAAAGTCAGCAACATACGCACATTTAGAGTATGTAACACACACTACCT
TGACAAGGGCCGATTCGACAGCCTTCACTTGAACCAGGAACACCCCAAGTCTAGAGTATTTTTGCATAATTGAAGCACTGAAAAGTACACGCAGCGGCTG
CTGCGCAGCAAACGTGAAGTGCATACACTTCATCGTTGCAATATCGATTCTTGCACTGCTGCTAGCACTATCCAGCAAGCTGAAGTCAACTCGAACACGT
AGCCGACCACCAATTTGCCGCTGCGAGGGTGATAACGAGTTGTTTTCAAACACCCCTTGTACCGCACTCTGATGAAATACGTTGAGTTTCTCACTGTCAG
CCCACGCGACTGGGTTTGATTGCATGTGAGCAACCAACTTTTCGGTGAAAACACTAAATACGTCTTGCTGCGGATAAAACAAATGCAACAACAGCAGAAG
TGTTAGAAGGTGTTACCTTAATCGGTCACACTCAACGAACAGCCTACAAAATTGACTCACCTGCCCCATTAAGACAAGCATGCGAAGAGCATCTACGTGC
TCCATGTAGCACATTTCGTCTCGAAAAATGTCGGTAATTTCGCTGTTAAGGCCCTGACACTGAACCATCCAGAAGGAGAGTGTGTTAGTACGCCACCCCA
ACGCACAGAAAGCAGTCAGTTAACACACCTTGCTTTCGATATGCTGGGTGAGACAACGCTCCAAAATCCTGTTGAAAGGTATGCATTCTAGCATAATTT