Description :
From Genome Similarity Track
Location :
scaffold_26:188542- 191230
Sequence
2688 bases(100 bases per row)
GGATGTGTCCTTAGCCATCTTGGCAGGTCGAGAGTGGAAGCATTTCTATGGCATGACACTACTCGGAATGGACCGATGAAACGAGGTAATAGCATCGAGC
TTTTCAAGCTTGGGACCGCATCGTCTGACAGGTTCTTAGTACTAAGTAGTACATATATCCTATTACAAAAAGACATACTGCTGTGACGACCTCGTCAATC
TGCGTATTCTTTTGCAGATCTTACGCGTTCGCTATTGCATCTTGCAcccgtgtgatcacattcagACGACCCTTGCTGAATGAGTTCAGGGCGTCCTTGT
GCTTGCGCTTCACATGCGCATCAATTTGGGAGGAAACAATTTGCCGAGCTCATCCCCACTTACATCGGAGACACTACTCATCGACTAAGCGGTAATCTTG
GGTGTCGTAAGCCATTCAAAAAAATGGCGTGAATCCTGTAGATGAAATACCCAACTTGTTTATAGTAAACTCAACCAATGGTAATAACGAACTTCATTCT
ATGAGATGTTCCGCACAGAATTTTCTAAACACATCACCAACCAAAAAACACGGTTAGAATGTTCCGTTTGCTCATCGATCTCCGGGTATACCGCTGTGGA
CATATCCAAGCGAGTGCCCAGAAATCAatacaacttttcaaaatcagtttgTGAATCTTGTATCACGATCAGAGGCGATGGCGTCTGGTAAGCCGTGCTT
GCATAAATATGATTAACGAACCTTCAGTATCGATGGCGAAGCAAtgcaaaccatcttgctgagtctgCCAACAAAGACGAGCACCCCATTATGACCATCA
GCATTCTCGAGCAAGCCAAAGATGAAGTCGAGATCGATTGACTTCCAACAGTCAGTACGAACAAGAAGCCTTTGCAGTGGCACCTGTGTGTGCCGTGCGC
TCTTCATGCGCTGACAGACATTGcatgtcttcacgtatcgTTCCACCCACTTGTACATATGGGGCCGCCAAAATGGTGCACTGAGAGACTGGTAAGTTTT
CTCACGGCCAAAGTGACCGGCTATCGGCGTATGATGTGTCTCTTACACTATCCTAtacttcaaatcatcgttgtgGAGAACCTCAATCCGTGGCTCGTCG
TCATGTGCAACTTCATAGTGAAGAGAGCACCATTCCATGCGTAACGATGCAACCATGATTTCAAGAGACCAGGAAGCATGTCATGAAACTCTATTTGACT
CGATGACAGTGCTATGATTAACAGATCACACTGTTCATCCTCAACATACGCTCGAGTTATAATATCGAATATATCGTTTTCGATATATATGATATGAGCC
AGCATAAAATCaggacgacgtgacaatgcgTCTGCCGGTACTTTCGGTTTCCCTGGCTTGTTCGAAACCGTGTAGTTGTATATTGCGGAGAATAACAACC
AGCGAGTCATTTGCTGTGCTAAGTGAGACGACTGAACTGCACAACACAAGCTTGAGTGATCCATGTAGACGATAATTGGAGTTGAACACAGGAGGTGAAA
ATGAAATTTTAACAAAGCATATTTCATTGCCAGAAAGTCTTCGTAGAGGAAACAGTTGTTTCTCTCTGCTGGCTTCAGCTGTCTCAATTGCTATAACACG
ACACGACCGTGTCTTCTTTAGTCGTTCTGCAATAATGCACAACCGATTGCAAAtttgaagcgtcacacaccACGCTTAACGGCTTTGTATCATCTGGTAA
AGCAAGTTATTGTGCTTTAACCAAGCTATTCTTGATTTGAGTGGTGCTTCTTCACAGATGAATGACCACTCCCACGGTACGTCCTTCTTTAGCAAATTCG
ATAGTTGTCGTACCATTTCCGCGTAGTTACGCGAGAGCGATTCAGGTGATTGGACAAACCAATCCATTTCCTCAAATCCATCTGGTTCCTTGCGTCGGCC
TTTTCAAGGTCTGCACGAAATCCATGTTAACCAACATAACAACAAAGAGCCGGTACTTCATTAGCATCAAAAATACACTTTGCAAAAATCTCTTGCAAAA
ACCGTTCACTAATACATTCTAGCACCGCACGAAGGTGCTCCAAGTGCACTTCTGCGGCAGATCTGCTATCTTTGTCCTTAAATGAACGAAAATATTGTCA
AAGTATAATTGTGCAAAGCGTCGCAGTTGTCGGAACAGATGTGAGACAAATCAATTGAATGTTGTTAGGACATTGCATAgaccttgtggcatcacaaacg
tTGTGCTATCAGCTGTCAAAGGGACTTTCTTCTCCCTCATCAAAATTGAGTAATATTTATTGACCAAATCAAGTACACTAAACTGTATACAGCCGGACAT
CCGGTGGATGGTGACATCTTTACGCGAAATTGGCATTTCCGCGTAAATCGTCTGTGCATTCAAATTGTTATAGGAGTGAACGATATGCTATTAACCGTTT
GGTTAACGCACACAAAAAGCAGGCGTGCTGTGAGGGACTTGCACTCCCTTACTAAACCAGCAGATTGCTTTTAAGCAGAGAACTTATCGACATACTCGCT
TTTTGCTCCGGCGaaagtggccactgtcgaagCACTGCATGCTTTAGAACAAATTCACGATCAATTTCGTGTCGAGTTTCACGTTCGGGTAGAAGACCAA
AGGGCAGATTCGCACAAAGAACGTCATCCTTGAATTTAATAACAAGTGATAAATAAGGATTTGTTATATCCTTCAGAATAGCAGATTC