Description :
From Genome Similarity Track
Location :
Scaffold_1:1885376- 1894525
Transcript NameFunction/comments
g585.t1hypothetical protein
g586.t1OWZ18414.1 hypothetical protein PHMEG_0007497 [Phytophthora megakarya

Sequence
9149 bases(100 bases per row)
GGTCAAACCGTGCAACAGCACACTTTCGATACGGCCGCTCGGTAGGCAGCGCTCGCTAGACAAGTATTCCTTGATGGCCGACAAACCGAAACCACCGGGC
ATCTTGCTTGCCAGCATCTTCGCGATCAGAGCACTGGTTACCTTGCCCGGGGAAGCGTAGTCGGGGAACTTGCCCGCCAGCTCCGCCAGCTTCATCTCCG
CTGCATCGTCAGGGCCCGAGCCGAACTCCTTCTCCAGGTCACCAACGATCTCGTTCTGCACAGCCGACTTGCCGGCAGACAGCTCCTTGATGGTGGCCGT
CTCCGGGATCTCGCTGAAGTCCTTGCCGAACTTCGCCGCAAGCATCACCAGCAGAGCGTGCTTCGGTTCAACGGACTTGTCACTCACCGTGGGGATCGAC
ACCGGGGCCGGGTTGAACGACATCCCAACAGCGCCAGGCGTGGCAGACATCGTCGGGCGGGCGAGAGAGACGCCAGCAAACGACTCGTAGCCGCTCACGC
TGTCGTCCAGCCACTTGCGTGCATCCGCATCACTCTTGAAACGAGCCTGCGGGGCGAGGAGCAGAGATTGAGCCAGGACACTCTCCATGCGACCAGCACC
GAGGCCCTTTTCCGTGCCCAGGTACTCCTTGATGCTCGACATCGTGAAGCCGCCAGGCATCTTACTCGCTACCACCTTGTTGATCAGGCCATTTGTCACC
TTGCCCAGCGCGTTGTAACCGGAGAACTTGGACGCAAGCTCCTTCAGAGGAACTTCGCCAGCGCCCTCGGGGACACCACCACCGAACTCCTTCTCAAGGT
CACCAAGAATCTCGTTCTGCACGGCAGACTTGCCGGCACAAAGAGTCTTGACGTCCGTGTCCTCCTTGATCTCGCCAAGCTCCTTGTTAAGCCGCACAGC
CAGAAGCACACGAAGCACGTGCAAAGCGGCAACCGGTGCATCCGCAGCAGCCGGAGCAGCGGCCACCGGAGCTGGAGCAGGCACCTGCTGGACAGGGGCA
GCAACAACCGGGGCCGGAGTGGCAGGGGTCACTGCCTCCTCTGTCGGAGCAGATTCAGCAACCGCCTTCGCAGCGGCAGCCGCGGTCTCAGCAGCAGCCT
CGGCAGCCAAACCACGAGCGTACTCAGAGGCAGAGATGTTCGACGTCTCCTCCTCGAAGTGCACAACCTCGCGGTCACGCTGGTACCACAGGATCTCACG
CGACACATCAGGGAAGTCGCCAACCTGCAGAGTGCGCAGCGCCATGTTTGTCAGCGTCGCGGCAGGACCAATCTCCACGAAGCGACGAACACCACCCTCC
GAGAACAGAAGCGCCTGCGTCTTGATCCACTGGACAGGAGAAGCAAACTGGTACGCCAGAAGCTCCACCACAAGCAGGTGCGCGAGCTGAGCCTTCGTCG
TCAGCTTCCACTGCATTGGGTCAAGAACCTCCGCGAGGTACGGACTCTTGGTAGCCTCGTAAACCTCCTCGAAGTACGAGCGTTCCAGCGAGAACGGAGT
GGCCACCAAATTCGGAATGTAGCGGTTCACCAGAAGCGGCAGCTGGCGCTCCAGCACCTGCGGGTCGAACTTGGTACGCAGCAGCGCACGGAACGACGGC
ACACCACCAAGCAGCTCGCGCGAGTGGAAAGGCACATCAATGCCAACCAGCGGGATCGTCGCCAGGCCTCTTGCCAGGGTGAACGGACGACCGCTCTGCT
CACACTTCTCCTTGCGGGAACGGGCTTGCTCCAGTGACTCCGCAATGACCTTCTCCACGTCCTCAGCGGCGGTCGATTTCATCGTCTTGAAAGCGGACAG
CGCAAGCGACAGCGTCTCCAAGTTCACGTTTTCACCAGCAACGACATACTGGCGCTGCTGAATGTTAAAGTTCACCACTTGCAGAAGCTTGCCTGACGCA
GCCTCCACGCCGTCCACGATTTTGTACATGACCTCTTCCGTGAAGTGGGGGCCGACACGAGTGGGGTTCGTAGCGACCATACCGTAGTCAGAGCGGCCCT
CAGCATCGCGCTTCACGGCTTTTTGCATTATCAAACCGCGAAGGAACACAACTTCGACAACATCCTCTACCGCCAAAGCACCAGCAAAAGAGCTCAAGCC
AGCATACTCGCCAAGTGAATGTCCGGCAAAGTGAGCATCATCCGGAATCAACTGGGCGGCCTCGATTTCAGAGAACATGGCCTTTTCCAGCAGCACCAGT
GCAGGTTGACTGAACTGGGTAGCGAACAGCAAACCCTCCGGTGCAGAGAAACTAAAGCTTTGCGTTCGAGCGTTAATCTCGGGCAACAAGGGTGCGATTT
CGCCAGTCACTGGGTCCTCACAAGTCAAGCTCATGTACTTCTCACGAATCTTACGGCCCTTCTTACCACCAAAGTGGACCGTAATCGAATTGGGGTTCTT
GCGCACCATATCAAGAATCGAGAAACCAAACGTCTTCCGCAAGTGGGTATCACCACGGTTCCAAATCTCACGGGCGACTGAGGACTCCTGGTAGCGGTCC
ATACCCATACCAACTGCAGCAGAGCCCTGGCCGGTGAACACGAACGCCATCGGCGCTTGCTTCACGACAGCACGAGCGCTCACAACGCGCTCACCGGAGC
CGTTCACAACCTCCACCGACAAAACCTTCTTGCCGTTGTCGAGACCGATGTGGCGTGCCTGCATGAACAGCTTGTCACCCGGGTACACCATGCCGTCGAA
GTTCACATCGTAGTCCACCACGTTGCTGTCAACGCCTAGACCAAAGCTCTGAATGACCAGGTCGCGGACCTTGGTCGCAGTCCACAGACCGTGCATGATC
GGCTTGCCCTTGGGAAGGTGGCCCAGAATGGCTGCGTACTTGGAGCGATGGATCGGGTTCAAATCACGAGAAGCCACCGCATACGCCAGGGCGTTGGTCG
GTACACTGATCTCCAGCGGCTTATCCAGCATGTGGGAACCACCGTTCGCGAACATACCGCCGGACTTGGCATCTTCCGGCTGCACCTGGCGCAAGAACGC
CACAACAGGACTCTCGTTCACGTCGTGACTCTTGAACTCCACCGTGCCGATCTCTACCTTCGAGCCCGCCTCCTCACGGAGCAGTGTGCCTGACACCTCA
ACAGAGCTCAACGAGCCGATCGACGCATACTGCTTCTTCGTCGTCAGCTGGAATGCCAGGTGATCGCCAACGTTCACCGAGGCCTCAGCAGCAACCTCCA
GCCACCCCTTTGCCTTGAGAATCTCCACATCTTCCTGGCGACTAGGCACAAACTCCTCTGTCGACTTGTCAATCGAGAAAGTCGACTCAAAGTCATCGAA
AGAACCGCGGATGAGGAACTCGCTGTGTAGCTCCACGAGAGGCTCCAGCACCTCCACCATATGCTTATCCACCGTCTTGCGCGAAATAATGGCAACACCG
TGCACGATCTTGCCGCTGTCGATAATGCGCAGACTTCCAACGTTCGACGTGCTCACGATGTCATCACCAGGCAGGAACGTAGCGGAAGCCTTGCGCGACG
ACAGAAGCTTGTACGAGTGCTTCAGGTGCACCAGGTCCAGCAGGTTGCCCTTCACCTCCTTCGTGAACACCGACTGGATCAGTGGGCGCCACGACACGAT
CGTCGAGAAGTCAGCAGGAGCGCCGACCTCCTCGTCACTAAGACCCAGCGCAGCGCGGTATGCCACGATGTCCTCCTTCGTAATGGAGAAATCGGCCGTG
AAAGGGGACAAAACGCTCTCCGCGCATGCGGCATCGCACGACTCCTCCTCCTTGCCCTCAATCGCCACCCAGAAGCGCGCGTAGAACGCCTTCACCTTGT
CGATGAAGCCGCTGCCTTCAGCGTGGATCGAGCTCGACAGCTCGGGGTGGTGCTGGAACGTCATCTCCAGCGCCACGACACCAGCCGACAGTCCGGTCAC
GGCCGGACGAACCTCGTTCACAACGACCGCAATGCCCGCGCTCTTCTTCGTGATCTCGATCACAGGTCCCGAAATGTCGATGGAGCTGTCGAACACACGA
ATGCCAGCGGCGTCGATCACGTACTTCTGGCCCACCTGGGGAACGAGAAGCTGACGGACCGGGTTCGCAAGCCACTTCTTCTCCTCGACGACATACGTCG
ACGAGATGAGCGCGTTCAGCCAGTCCTTGTCGTTTACCGACGAAGCCAAAGCAGCAAGCCATTCGCCCGCAGAGGGAAGGGCGCTCTCCTCAGTAGGGAT
CGACACTTCCACGCTGTCCTCAGCCTCCGTCACTTCGAAGCCGGCAATGTCCACTGTCTTCTTGACAGGCGGAGCCGCCACAGCAACGATCGCACCGCTT
TCCTTCACAACGTTGGCGAAGCCGTTGGCAATGCCGTCAAGGATATCCGCAACAGGCTCGTCCACCACCGTGCTGTAGCGAACAGCCACGGGCCCCTGGA
GAACGAACACGCGCTGCGCATCGCGCGCCGGAACCGCGTCCAAATCCTCCGAGTACCACAGCGAGTCCTTCTTGAACCACGTCTTGAACTCGGTGTCGAT
CACAGGCACAAAGTTTACCGGCTTGCCACCCGTGCGGCAGAGGTCCAGGAAAAAGTCACAGTCGGGGACGGATAGCAGCGTCGACACCGTCTGAGGGTAC
TTTGCAATAAAAGCACTCACCGTACTCCTCGGGTTCGCCTTCAGCTCCGACTGGTCAAACAGATCGCCAGAGCTGTCGCGGCGGAAGCGCTCCTCCGTGC
GCGTGAGGAACTTGCTCACACGCGAGAAGAACGTGTCGTGCACCCAGCGCTGCGGTTTGCCTTCGATCTCCACGTACGTCAAATCGATCATACGCGTCAG
CACGTCTCCGTACGACATCTCCTCCAAGTCAGCCGAGACGCTCTCGCCCGTCTCGACATTGCGCTTGCAGCCGAAGTACGGCTTCTGGTAGTCCGCGTTC
AGACGCGCAATGATGTCCTTCTTGTTGAGACGAAGCGCCAGCTCCACCTGTTCGCGCGGGATGGAGAAGTACTTGTCATCAAACTCCTTCCACAGCAGAG
CACAGCGGTTGGCCACAACGTGAATGGGCTCGCCCAGCTCCGACGTCACCGTGATCACGCCGCCCACAGCACCCGTGTAACTCGTTTCCCACTCCAGCTC
CGACTCGATACCGGGGGTGTCCACAAGCAGCTTCTTCACTTCCGGCGCCGTCGCAGCCTCCTTCGCAACCATCACGCGAGAGCCCAGCAGGATACCATCC
GCAGGCATCTTGTGCAGGTGCCCACGGGCCAAGCTCCACTCGCCCGTGATGTACTGCTTCGAGTCTTCCCAGTTGCCGAAACCAGAGCCGACAACCAGCA
ACACGTTTGGCACGCGCCGAATGTCCGCGTACGTATCCTCCATCGGCTGGTGGAAGTCTTCGAAGCTGTGGTGGCCACCGGCGCGACCGCCAGTCCACTG
CAGCATCACATCCATCGTTGGCATCGCCGCTGCAATCTCCAGCACCGCATTGATACCGTCCACCGAACCGGGCTTAAAGCACACCACATTGATGCCCACG
GCCTTCAGCTGCGACATCATTTCAAGCGCACGCTCCTTCGTTGGGATACCGGCACCAATCGTAATGCTCTCGATAGGCACACCGCTACTACGCATGCGGA
GCACCATCGGAAATTGGAAGCCCCACTGCTTCGCGTTCAGGTACAGCATATTGATCGCAATGCCGAGGCCAGGCTTGATCTTCGACACGAGTTCATTCAC
CGCATCCTCGAAGATGTTAGGACGCGACAAGCCACCCGCAGCAAGCTCGCCGTGGAAGCCAGCGTTCTGGATAGCCGCCACGAGGTCGATGCCCTCCAAA
CTGGTGGTCGGTGTCATGCCTGCGACCATAACCGGCGGCTTGTTCAGCACGCGCGTGAATCTGTTGCACAGCTTGCCCGACTCCGTCACCTGCGGGCCGA
ACTTCTTCGCCCACGTCGCCTCAGCCGAGGTGAACGTCGAAGCAGCATCAATGAACTGCTGCAGGCCGACCAGAGGAGCGTACCTCGTCGTTGTGTTCAT
GATCGGGTGCTTGGCAGTAGCGATCACCACCTTGATGCCCAAGCCTTCGGCGGCCTTGTCGCTCAGCTTCGCCACGCCGAGGTCCGGACCAAACTCAAGG
ATGTGGGTCGCGTTCGAGTGGTGCTCTGCGATCTTTGCCCACGTCGCAGTCCAGTCCACGAGCTGCAGCAGCTGCATGTTAATAAGTTCATCGATCACGT
CGTCCACCGTCTGCAGGTTGGTGGCCTCCGCGTTCGTAGCGTACACGGGCACCTGCAGTTGGCTGCCCTTGATTTCGCACTGGACGCGCTGCACGTCCCG
CACCAGCTTTGGCTTGGCCTCACTCAGCAGCGGTGTATGGAAGGGTGCCGAAAGCGGAAGGAACGAGAGCGAACCCGTGGGTTTCCGCTGCGAGTGCGGG
ATGCGCGTTTGCGTGGCGTCGGGCTTAGCGAACAGGCCCTCGAGCGCCTGCTTCAGCAGCGTCAGCGTCGCGGGGAAACCCGTCACGTTCATCATGTCTG
GCGCATTGATTAGAGAGAGTTGGAGGTCAGGTGACTTTGTCCGGCGCTTGGCAACTTCGATGGCCTTGACGACGTGCTCCTTCTTGAGCCCCCGCACAGC
CAGCATGGGGCCGGCGTTCCCAATCTTCTTACCATCTTGCTTGTATTGGGTCAGAAGCTCCTGGTACGTCTCCTGCGCACGCAGTCCCTGCCAGAACATG
TAGCGCAGCACGAAGACGCCGACGTCGACGAACTCCTGGGCCGTCTTGGCGACCGAGAAGATGACGGCGCTCACCACGCCCTGGCTGTGGCCAATGGCCG
TGGCGGAGCTCTTGACCACGCTCTCGTGGCTCACGCCCGTGGTCTCGAGGAAGTTGAGGTAGTTGGCACATTGCGTGAGCACCAGCAGCGGCATACTGAA
GTAGACGCGGTCCAGCGCCAGCTTTGCGGGGGCGTCGCCGACCTCGAGGCTCTGCAGCCAACTGTGCACGTCGATGACCGTCTCAAAGGCGACGGAGCAC
TTGGCCTCATTCGTGCTGGACTCCTCCAGCAACGCCTGGGCCGCGCTGTCGATGAACGCGCGCGTGGTGCTTGTCTCGGACGCGGCGTAGAGCCGCTGCA
ACTCGGTCCAGTAGGAGATACCCTGGCCACCGAACTCGGGGATTAACGTGAACTTGCCAGTGTCCATTGCGCCTGCCAGCGCGGACACCGACGTCGTCGT
CTCCTCCGTCGTGGTGGTCGTGGTTGTGGTCGTGGTCACGACCGTCTCCGTGTTCTCGCCCGCCGTCGTAGTGGTGGTGGTTGTGTGGATTTCCTCGCTC
ATGATAGTGGTGGTGATTGGCTTTCGTGTAGTAGTGGAAGCGCAAGCAGGGAGAGAGAGATGGCTGCGTCTGGAGGCCCTTCTTCGCCTTCTTCCTTTGT
TGTCGTTTCCTGCGCGTGCGAGTGCGGACGAGTGAGCTGCGAAAGGGAAATGCTCCAGTGGGGAGGGCTGCAGCGCGAGCCGTCTGGGCCTGTCGATTCC
CTCTCGCACCGACTATGGATTCCCCGATACGCAGTCACCAGGTAGAGGACCATCACTCTTGCAGACGTTCGCGATCTGCTGACGCGCAACCGAGGTGGCG
CATCATTACTGGTAGGCTTGAGCACTTTCATGATTAAATACCCCGTAGTATGCGAATGTACGGAACTGCCTCATTAGACCGGACTAACCTCCTGTATCCG
ATTCCCATGCGAAATCGGATCGCAGCAGATGCACTGATTTGCAAGGGGTAGGGGACGTGACGCACTTTGGCTTTGGCCGCCTCGGCCGTTGACGTCACAA
CAGCGCTTTATATCGGCGCGCTCGGCTCACCAGCCGGAGCTCCGCTGCAGCTTCTTCAACCGAAAGCGCTGCTAACTAGAACGCCCACCGCACTGCCTGC
GACCTCTATGCCGGGGCTGGAGCGATTTAGTATGCGCGCCGCGCCGAGTCCAAGAAGCGGGGCTGAGCAGCAGGATGCCGCCTCGAGTACCGAAGCGCTG
ACTGCCCGCCGGTAGCTTCTGAAGTTTTGCGCGGGCGTGGGACAATCTAATTGGAGTAGCCGGGCCGCAAGTGCGTCACTCGCGGCGCCGCGTGACAGCA
GATACCTGGGCCCGCGAGCTCCGCAGACGCGAATTCTGGGGGTGCTTCGGCGGACACCGTAGCGATTTGCCTGCCAAAGAGAGACGCGGCTGCCCGGGAC
CGTACCAGCGTTTCAATACGGGCAAATAAATACCTGCGCATGCACGTTCGTCGGCGTGGGCTGAAGCGCAACACACGCACAGGTGAGACCTTGATGTCCA
CGCCACCTCCCTTCCTCCCGTGCGTGCGTGCCGCAGAGGAGCTAGCTTCGACATCGTTCCGCGGATCTGGCGGCGGTGGCTGCCAAGTGCCAACTCATCG
CGTATACCTCGTCACGTGAGCGCAGATGATTGCCCGTCAGCTCCGAAAGCACCACCGAACAGCCCCGGACGCTCGGCGTCTTTGCCGCTGCCGTGCCAGC
TATCCATGTATCGATACAGCCCAACGGTGCGGACCCTCCTCCTCCTTGGTGCTTCCGTGGCTGGGTTCTGCACGCCAATCAATCGAGTCCGCGCCGACGC
CAACACGGCGCCACCATGCGGTCAAGCGCGTCGATATAGCGGAGACACTTCGTCAGTTATCAGATGGGTACGCTAATCAGCGACGTCAGCGATTGTTGCG
CGAATGTGTGTCGACGACAGCGCGTCGATACGAGCGACCTCCAAAGTTGAAGCTCGGAACGGTCACTGAACTGACTCCCTCATTTCCATCAATAGTGACC
GAGGGGAGGCAAAAAAACTGTCGTCAGCCGCAGCAGCAAGCCATGGAGAAGGACGAGCTGCTCAAGGGGCTGTCGCTCCACGAGAAGCTGGCCTACTTCT
ACTGCTCGTACGTGCACGAGGACGAGGTGGACCCGGAGGTAGACGGCGATGCCGTGCGGCGCTGGGAGAAGATCATGGCGTCGCGCCGCAAGTCCCGCGA
GCGCGTGTGCATCCTGCTGAACCAGATGGAGAACACGTCGGCGGCCAACGTGCGGACGCTGGACAAGAGCTACCGTGCCAAGCGCGAGCTGTTGCTGATT
GCAGAGGGCACGATACGCACGGCGGCGAGCAACGGTGTCTCCGCGTCGG