Description :
From Genome Similarity Track
Location :
Scaffold_79:188516- 196444
Transcript NameFunction/comments
Physo_158052hypothetical protein
Physo_139866hypothetical protein
Physo_139867predicted protein

Sequence
7928 bases(100 bases per row)
TGATTCGTTAACGGATCAAAGTGCTGCTCCTCCGCCACAGCATCATCGTGAATCCCGCTGCATACGTACAGCGGAATTTCATTTGGAGGCACGGTGTTGC
CCACACGGTCTGCGATCTCTGACGCAGACGGCATCCACGGATCGCGCGCTGCTCAGGCAGCGCGCGGAGAACTTGTAGACGCCACCTCACGCGGGGAGCT
TAAAGCCCCAGCAGCGGAGAGCGGAGTTTTGCTCTCGCCGCGCGAACGCTTCGAGCTCGAAGCGTCCGAGTCGTCTCCTTCACGAGGGCGTCTCGACCCG
GCATGCGGGTCGAGACTATCACTGTCGATAGACTCCTTGCGCTTGTTGGAAGAGGGCGAGGCCTCTTCCATCTCCACGTCGTCGTCTTCGTAGTCAACGG
CGTCGTTGACTACAGAGGAACCTTCGAGGACAATCTCCGACTGAGTTGTCCCCGACGCGGCCTGTGCAGCGAGCGCGTCGCGCTTTGCCTGCTGACGCTA
ATGGTACTGAGCAACAGAGAGGTTACCCTCTGTTGCGGCGGCGGTCTTCTTCTGCGGCGAGCTCATTGCGGAATGAGCTCGAGTTTTCTTTCTCCCAACG
TGAAGAATTGACGAATGGTCATTTTCCTGATTGACGTGCCGTGACTCGGCGCGTCTAACCTTGAGGGGGGGATCGTGTAACCGGGTTACACGCACAAGTG
GCTACAGTCACTTGTAACTCTAACAGATACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATACATTTAC
GACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTCTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGAC
AACCAGCCGTTGGCAGATTCCTAGTTTAGAATATTACATTTAGAGGAATTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTA
TTTGGATCGTTTCTTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTACCTCTAATTTAAACTAAGCTACGCTTCCTCACATTCACGCGCACACGTG
TAGGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACAGTACTAAATTGGTTATTTTGGATTTGGTCCGAAATAGTGCAAAGACGCCATTGGCCGCTGTCCT
CAGACAGAACACGCGCTGGTCGTCGACCTTTTCACTGCTCAAGCGCTATTTTCGTCTCCGTCCGTTTATTTTGGCAGACGACGAGGAGCTCTCGGACTTC
CTTCCGTCACGCTCAGCCCACCGCAAGCTGGAGACTTTGCTGGCAAGCCTCCGGGACGTCGAGTCTGTGTCCAAGCACCTACAGGATGGCCTTACGCTGC
TGGACGCTCGTGTCCTATTCGACGAGCTCCTCGAAAGCCACCCCTCGTTCGCGAAGTATCTCGGTAAGGATAAAAATACAATCAGACGCAGAATGAGCGA
TGATCATCGCTCATTCTGCGTCTGATTGTATTTTTACTTAGCTACTGTGTTTTATTGTTTTTATATATGCATAGCCACCGACGCGGATATAGTCCACTCC
GCCGTCTTCGAGCAGGTGGTCGTCAAGGTCCTGGACGACCAGGCGGTCCTGCTGACGGACGACGAAATCGCTGCGCTGGAGCCGTTTAAGGGCACGCAAA
CTAATCTGGAAGGCGTGGACTGCACGCCGGCGGACAGGAAGGGTTCGTAGTGCGTACGCGCAAGCGACGCAAGGTAGCTGCCGCGCCGGCCACGTACGAG
CTGCTTAATGCGATTCCTCCTACCTCAAACGTGGTGGAGAGGCTCTTCAGCATTGCACGCGCTGTGCTGCGCCATGAGCGCCACCGCCTCTCTCCCATGA
TGCTAGAGATGATCTTGTTCCTCAAGATCAACAGCTTGTACTGGGATGTTGCGATCGTGGAGCAGTGCCTGTAAGTAGGTACAGTCGTAACATGATTGCA
GTAATTTTCTGTGTCAACACTAAGTCTTGCCTTATTTATTCAGTCTGCTACTCGGATGCAATGCAATATTTATTATGGTGTCCGGCAAAACAATAGATAT
AAATCGTATTTTCGGCATGCCTGATGCTCAGTGTCGGAATAATAGGTACAAATGTGTCGGAATTATAGCATCAAATTGAAGTGACCATCACTCCTGGATT
CCGCAAAGCAATATGGAGATGACTGGCAGCGTCATGCGCTTCGCCTTGGCCACGTACTTCATGAAGCGCACCGGCAGCTCTCATGAATCACCGGCTCACA
TCGCATCGGCATGGAGTTATGCGCCCAGTATTGCCGGCAGTGATGCCAGTGGCGAAGAGGAAGAGTGCGAAGACGTCGACTCGGACTTCTCCAGCGTTGT
GTCGACCCACGTATCGAATTTAAAGCAGTTGCTGGATGAGAACCGCTTCCAGGAGTGGTCGGGAGGCGTAGCTGAGCTGCGAGAGTATGCTGCAGACAAT
GATCTGCTGGAGTCTCTGGTGGTGGTGCTGGTGAAGATGATAAGGAGTCAAGAAGAGGACGCGGAGTGCATCACCCAAGGTAAAGAGAAGTGCAAACGAT
AAGAGGAGTGTAAATCTTCAAAGAGATCTGAGGTGTTGCAGTGATTGAGCACATGTGCTTCGAGAATAGCGGGGAGCCGTCGCGAGTGTTCGACAAGGTA
GAAGTTCCACCAAGCGGTTAATTAACAGACCTTTGGTTCGCTGACTTGTGGCGTGCGAAAGTAGCTGACAGAGTTGCTGTTCGAGGCACTGGCTCATTGC
TGTGTGAACGAAGGTACAACCGAGGCAACGTGGCTGCTCCGAGCTGTTGGCGGGGTCGCGCGCGGACTGCGCCAGTATTATGAGCAACGCTATGGAAGAA
GTCAACACTCGGTTCAAACCCTGGAGGCAGAAGCCAACAAACTCATTTGGGAAAGTCTGGCAGCTGCTCAACAGTAAAGGATCATCGACACTTAGATGCA
AAGTCCACAGCTCAGACACGTTGTATTTCTTTCTCCCTTCTCCTTCCATTCATCTACGTTGACGGCCGGTTACTATCATGTACGCGTCAATGGAGCCTCG
CATTGCCCTGACCTCGTTTATTGACGTCTGCTTTCCTGTAGATGCGACTTGGATCCCCACGCTTCTTCTACTGCCGTCGAAGCGATATGCGGGTACTATA
CAGGGAGCCACCGCCTAACTGTTCTTCATGGCATCCTTCACAAAGTTGAACGAGTCGTCCTTCTTCTTCATGAACCCGAATCCTGAGTCGGACGCAAGGC
TGTCCGTGGGCTCCTGGATGGTCTTGGCGATGTAGCCCGTCGGGGTCATCGCAGCTCCGATCACCTGCGAGCCCGGGTTTCCCATGCCCTGCATCTGTTG
CATTTGCTGCATCTGCATTTGTTGCATGTACTGCATCTGCTGCATTTGTTGCATGTACTGCATCTGCTGCATCTGGGCCATTTGCTGCGGCGTGTTGAAG
TTCATCATGCCTATGTTCATGGGGGCGCCGAAGCCCTGGTTCATGGGAGGAGCCTGCACAGGCTCGAGTAGAGGGTCCAACACCATCGTCTTGTTCGCGG
AAGGCGCGGGAGCAGGTGCTGCGGGGGCGGCAGGGGCAGGAGGAGCTGGCTGAGCCGGCTCAGGCACCGATGCGGTGCTCGCTGTGCTACTCTGGAGCTG
CAATCCGCCAAACATGTCGGCCATCTCGTTTGCCGACGTCGCCCCAGCCTGAGCGGACTCCTGCGGAGCCTGCTGGGGAGGAGCATTCGTCTGCAGTCCA
GAAAACAGAGAGCCATTGTCCGAAGGCTCGTCGTCGAAACCTCCCAAAAGATCGGCCTCAGCCGCAGCTGGCTGCTTCCTGTGACCAGTGGGCTTGCTCT
TGGGCTTGGACGACTCGCGGCTGGATGTAGATGCCGACAGTCCAGCAGAAATGCCGAGGTGGTTCAGAACCTTCACGGCGCGGTCTCGCACGGCCGCCTT
GTCTGACTTAGCGCACTCCTCGATCTCGCTGGAGTTTTCGGAGAAGTACTCCTCGAACTCTTCGCATCCGTCCGTCTTCAACAGAGCGTCAATCGTAGCC
AGGGCCTTGGAAACGACCGTCCACTGGTCGTCCGAGAGGCAATCCTCCAAAATTGGGCCAACGATCTCCGCGTCCAGAGTAATCGCGCTTTTCAAGAACG
CGTCCATCTTGTCCTTCGGGGGAATAGCTCGCATGCCGCCGGGGGCACACAGAGCGGTGACCAGGTTCCGCTCGTACGAGCCATCGGATTGCGCGCCAGA
GGTCTGGCCTGTGAGAACAGGAGGTGGGGCCTGAGGAAAAGGTCTCGGTTCACGAGACTCGCGACGCTTGTTGTCGTCGTATTCGTAGTCGGAGTTGCGC
GAGTAAGAACGGTTGTCACGAGTGTTGCCGCTGAAGCTCTGAGTCCGACTCTCGGGTCCATTGTTCTGCATTCCGGTGGAGCCACCGAGGTTCGAGGGCA
CGTCCGTATCGCTCCACGCGCCGCCAACACGACCCTTCTTACGGTCACCATCTAAGGTCACACGCGCAGGTAAATGTTAGCTCTCTGTAGCCTACCAGCA
AATTTATCACAAATGAGCGTACCATAAGACTTCTCCCGCAGTTGCGAGCTCGCCGACTCGCGCGGGTCCTGTCCGTACGAAGAAGACCCGGGGCGGTATC
CGTACCCAGTCGGGCGGTATGGCTCCTCGGGGTTGTACGGCGCCGGCGTGGGGCCGTAGTTGCCGCTGGTGGGTCCGCGGTTGGTGGCAAAGCTCCATCC
CTCAGGCGGGTTGGCCGATCCGGGCGGGCCGCCACCGAACGTCGGCTTCGGGTCCGACTTGGAGTACTTGGACGCCACCTTCTCCTTCAGTCCCTTGAAG
AATCCCTTCTCGTCCGCTGCATCAACACCATATCAACAATTCTCAGTCAGGAACAACAGTACACACCCTCAACTGCAATAAATCCCCAATATCTCACCGC
GCGGGTCCTGGTACATGGGGTTGCCAATGCCCGAGAACTTCTGGTCGTTGAACGGGGGCGGCGCGCCTCCGTACTGGTTGGGCGGGGCGCCTCCATACGG
CGGGTTGGCCGCGCCGCCGGGGCCTCCGTAGGATCCCTGCGGGTACTCTGGCTGGTACGGCTGCTGCGGCTGGCCGTAGGGCTGCGGGCCACCGTAGCTG
CCCTGGTTCGGGTCGGTCGGGTAGCCGTACGGGGCGCCTTGCGGCGGCGCACTGCCGTTGTATCCGCCCATAGGCGGGCCCGCCATGGGCGGAGGAGGCA
GCGAGCTGTCGTTCGAGTTCTTGCCGCCCCAGATCTTGGAGCTCCAGCCGGAGCCGCTGCCGCCCGCGCCGTTGTCGTTCGGGTTGGCGCCCACGCCCTG
GATACGCGCCGACATGCCCATGCCGCCCAGGCCGGGCGTGTTGTCCGTGTCGTAGATGGCGTCCAGCACCTCCTTGGCGGCCTCGCGCACGCGGCGGAAG
TACTCGTCGCCCTTGAGCGGGTCGGGCGTGCCGCGGAACTCTGCACAGCAATAGTCGTCGATGGTCAGTCAGTATGGCTACAATGAGTAAAGGGCCAGAG
TGTGAGGAGCCGACGTACGCAGACACTCCTTGACGGTCGGGATGTGCTTCTGCATCTCGCGCTTGAAGTCCACGCGGCCCTCGCGGCAGACGTGCTTGAT
GACCTGCAGCGCCTTGTACTTGATGGTGTGGTGCTTATTCTTGACGCGCGAGATGAGGAAGTCCTGCACCTTGGTGCACGTGTCGTAGCTGTGCTGCGTC
ATGCGCGCGATCTCCCCGTAGAGGTAGCCGGGCGTCGGCGTGTCATCTTTGCTCGTGGCGCGGGTCAGCAGCGCCTTGTCCATCGTCAACTGGTCCTAGT
GCTGCTGCTGCTCGTACTGTGCGGGTGCTGGAGGGGGGGGGCTGGAGCGGAGGGCGGGCAGTCTCTGCTGGTGTCCCGCGGTCGCTTCGGTCACTTTCGC
CTCTGCCTCGTGGGGACGACGCCGGCTGCTTACTACGGAAATGTATGCCTCGGCTCTCCCCCCTCAAAGCTGCTGCCACTTTTTTCAAAGTTGACGTGGC
AGCTCTAAGGCTGATTATGTAGTTTTGCTTATAGTGGACAGCATCTGCGTGGTTGTTGGGGGCTAGTTATGCAATTGTGGAATTTAGGTCAACTCGACAT
TTGTATCTACCAGTTGAATATTTACTGATCTAGGTGGAGAGCTGCACGAACGGATGTAGCCATCTTGACTTGGCTCGAGTCGCTCACTGCCGAGAAGAAC
ACCGCCAGAAGGTCAAAGCAGTCGAGTACCGCAGGCATCCGATACACATTCGAGAGCGAACGTATGCAAGTGGATAATGGTTGCTTCCTGACATGAAAGA
CCGTCGTCGAAGGGTTTTGATCTCGTTGATGCAGTTAGACACCAATTTTGCTGTAGTAATAGTCGTCTTCTCCAGTTGAGAACAAGCGCAGTAGGGGACA
AGAGCCTTTTGTATTCCAATATACGCCGGGTTTGACGTGCCGCGGTCATTGCGGGACATGAAATACCCGTTCGTTCTACACTGTTCGCGCGATATGTACG
AGCGCAGCTTCTCGCGTCCAGAAGCCCCGTGTGCAACATTTACGTGGCAACATCCCGCACATGCAGCTGACTAGCCGCCGATCTCAGCCACCGCGGATAC
CTGGTTCACTCGCGCTCTTTCATATCAACACGGTGCCGTGCTCGGGCCCGGATCAAGACTCGACCTCATGCTCTCCACACTCCCAACACTTCCCCGGCAG
CAACAAGTCCCGACGTTCAGAACTAACTGATGACGACTCTAAAGAGGACATGGGCAAGGAGCTGCATAACCAAGACCCGGATCTGGAGGAAGACTTCGGC
GAGAAGGACTGGCCGTTTGCCGGCAAAGGTGACCTGGACGACGTCCCAGCCCCAACAGGAGCCGCCTGCACCAAGATCAGCAACGTACTGGGCGGAGCAA
GCGAGCACTTGGGAGACTTCTCCTTCGGGGGCCAAGCCGACCTGCTGCCGCCCGTTCCAAGCCTCTTTGTCAACGGCGTGGGGCCCGTGCCCGTGCCTCT
GTGGGAGGAGCGGGCCCTGAAGCTCATCGACAAGTGTGCCAAGTCCCCGTTCGGCCACAACATGGACACCAAGTTGGATGAGAGTGTCCGCAAGAGCTGG
CAACTGGCACCGGACCAAGTGCAATTCAAGAACCCATCGTGACAAGCGGGCATCGACAAGATGGCGGTGGCCATCGCCGACCGACTCGGGTACAAGGGCA
TCCCGCTGCAGTGCGTGCTGTTCAAGCTGCTGGTGTACGGGGAGGGCGGCCACTTCGTCAAGCACCAGGACACGGAGAAGGAGGACGGCATGATCGCCAC
GCTGGTGGTGCAGCCACCGAGTCTGCACGAAGGAGGGGATCTGGTCGTGTACCGTGACGGCCGAGTGAAGCACCGGCATGATTTCGGTGCAGCGGACGGC
ACAGCCACGTACCTGACGCACTACGCGGTGCATTATGCTGACGCAGAGCACGCTGTGGAGAAGGTGACGAAGGGGTATCGTCTTGCATTGGTGTACTCAG
TGTGCTTGCCGCCGACGATGCTGCACCTGGAGCGGAACCCGAACAAACCCATGAGCGCGGCGTTAGCGGACGCAATCGAAACGATGAAGCCGGGAGACGA
CTGCTTTGCGTTGCTGTTGTCGCACGAGTACACGCAAAAGAGTCTCCAGGGCTTGGGTGCCGGTGCGTTGAAAGGTGTGGATCGCGCGAGGTTTCAGGCG
CTGGAGGAGGCGAATGCATCAGTTTCTGCTGAGAAGAAGTTGGAGTTTCACGTCGTTGAGCTCCACCACGAGGTTGTTTTCTACAATGCTATGGGAACAT
CGGTGATTGGGCTGAGGAGAGTCGAGAG