Description :
From Genome Similarity Track
Location :
Scaffold_13:188516- 193121
Transcript NameFunction/comments
g18342.t1XP_008900932.1 hypothetical protein PPTG_08565 [Phytophthora parasitica INRA-310
g18343.t1hypothetical protein

Sequence
4605 bases(100 bases per row)
CCGGCGCCTCACCCATTCCGACTCTCGGACTTCTTCTACAAGGAGATTTTTGGCGTTCACGACATTAAACCTACCGATGGTATGCACCAGGAACGGGTGC
AGAACTTCTTTGCTGTGCCGTTAAATACCGAGCAGCTGTTCCTGTTTGGAGTGCTGCTCGCGCTCGATAGTTTTCTGTACGCGTTCACGTACTTGCCGCT
GCGGATTCTGTTCGCGTGCGGCTGTGCTGTGACGTCGGGTTTCCATACCAGAGTGTTCCGGAGGACTCACTTTTATGACTTGATGGTGGCTGTCATTATG
GCAGTGGGGACGACGGTGCTGTGGTATGTGGACATGTCGAGGGTGTACCACGCGATTCGAGGTCAGGCGATGATCAAACTGTACGTGTTGTTCACCATGA
TCGAGATCTTCGATCGATTGTTTTCATCGCTCGGACAAGATGTGCTGGACTCGCTCTACTACACGGCCAAGTATCAGCCACGTCGTGTCACGCGCATGTT
CCTGGACTTTGCTGTTGCCATCATCTACGTGGTGCTCCACTCTCTGCTACTTTTCACTCAAGTCGTGACTCTCAACGTGGCTGTCAACTCGAGCAACACG
TCGCTACTCACACTGTTGATTTCCAACAATTTCGCTGAGCTGAAGAGCTCGGTGTTCAAGAAGTTTGAGGAGCAGAACCTCTTCCAGATCAGTTGCAGCG
ATATTGTCGAGCGCTTCAAGCTTCTTACAATCATCTCACTCATCTTACTGCAATCGTCCGCAGGGGATGTTGCCTGGGGAACGGTACGAATTGTTCTTCT
CTCACTCAGATGATGTGCTGACGTTGTAACTGCATTTTTTGTTGCGTTCGCGCAGTCGATGGTTTGGGTGGCCGAGATGCTGATCGACTGGCTCAAGCAC
GCGTTCATCACCAAGTTTAATCAGATCCCACCGACGATGTATTCCAAGTTCATCACGATCCTGTGCCGCGACCTGACAGGCTGGAAGAGCGAAGACACGA
TTTTGGACCACACGCACCACGTGTCCAAGCGATTGGGTCTGATGTCGCTGCCTTTGGCTTGTGTCGTGCTGCGCATGGTATCGAAGGCCTTGGTCGATGC
TCCGATTGAGCTGACGTCGTCCATGGGAATGCTAGTGACTGTGGCGTTCTTCCTCTGCCTTGCAGCGTTCAAGGCGCTGCTGAGCCTCGTGCTGATGATC
TACGCGTGCAAATCGGGTCGCCTCGATGACACCCGCCCGAAAAGCCCGCGTTCCGTGCGGCACCTGGAGTCCATCCACCGCTACAAGTTCTAATGAAGTC
AACCGAATTGATAGACGCGTTGCTCTTCCTTCAAAAGCTTCGTTCATTGTCTTATGGTCATTTTTCCCTATTGCCTTTGTGTCGCAGCCAGAGCACGAGG
CTGGATGGATGTGTGAGCGGCACGCCAAACAGCTTCCAGCTTCCATCTTCGCCGCGGTCCTCGTCTTCACCTTGGCAGCGGAGTGGCGGCTTATTGATAC
AGCATACTGTCGCGTCTCGCCTTCACACATCCACTCCGCCACTCTGGCGCCGCTCACCATCGCCGCTTTTGCGGGGCTCTTCATCGTCCTTGTTCTTTGC
TTTGATACAAGTCCTAAACATGCATTATCCTCTTTTTGTATCTGTCTTATCTACAAACGCGCAAAACTTTTGGATCCTCCTTTTCCTGCTTCTTGTCACT
GCTTGGCGGCCTCCTCGCCCTGTCGTCGTCATACCCCACACGCCCCCCTCGCTGGTGGCAGGTTTATCCAACACTCCACACTTCACACCTGCTCCGCGTC
TCCAGCGGTACCGGGTCTTCCTTGCTTCGTCGTTCATACACCACACGCTCTTTCCCTAACTGCTGGTTCATACTTTTTGCCCACCACCTCGCTGGCTGGT
TGGGCTCTCCCTTACGCACGACTCGTGGCGTTCATGCCCATGCCGCCCACATCGTTCAGCATCATCATGCTGCCGTCATTTCCATGCATCTGCGGCATGC
GGTTGCCACGGCCGCCTCCCTGGAAGTGGTGCGAAGCACCCATGTGACCGCCCTGCATTCCGTACATCTGGTTCGGGTGCAGTTGCTGCTGGTGCATGTA
GCCACCGCCCATAGAAGACGATGGCAAGTGGCCCATCATCATTCCGCTGGCACCGTTGTCGAACAGGTTGTCAGCGCTCGGCGACATGCCCATGTCCATG
CTAATGTCCATATTCGGGAAGCGCTTGAGGATACGCGCGGTGATGCGACGACCGCCCGACGTGTTCTTCATCGCAGCCAAGTGCGGGCGAATAGCCTTCA
CGAGCAGCAGGCACTGCTCCTCAGCACAAACGCACAGCGCACGCTGCACCACGTAGTTGGCGAACTGGTCCTGCAGCATCTTGTTCATCTTCGGGCAACT
CGTGATCTCAGAAATGTACTTTTGGCGCACACGCTCGGGGGCCTTCTCGAGGCATTTCTCAATCACATTCGAGCTAAACTTTTGCACCGAAAGCTCGTAG
ATGTGGCCCAGCGGCTTCATAATGACACCGAAGGCCTCCTCAGCCGTACACGAGTCAAGCACATACTGCACCACGTAGTTGCCGTACGGGTCCTGCATCA
GCTTCATCGCTTGGCGCTCCACCTGCTCAATCACCTCCGCCTTTTGCGCCTTGTTGGCCGCGTCCAAGCAACGTTGCAGGACGCAGCATCCGTGGCGGTG
AGTTCCAACAGTCGTGCACTCCTTACACACAGCGTCAAACACAAACTGGTTGTACTCGGGCTTCATAAACTGCAGTGCACGCTGGATCACGTGATTGCCG
TTCGAGTCAATACACAGACGCACGGCGTCGTCCTTGAGCGCCTCCACAATAATGTCCGGCAGACTCGTCGTGCGGCGACGTTCTCCACCTTCTGGGCGAT
CCTCACGATCATTCGCATAGCCATAGTCGTCACCGTCCTCCTCATCGTAGTCTTCTTCAATAACGTCGGCAGACGTAGCGCACACCTCCACCACCTTTTG
CACAGATCGTGTACCGTGCAGGTTAAGAGCAGCAGCCACAAGGTTTGAGCTAACGCGACGAATGATCACAAGGCGCTGCTTCTCGTTCACACGTTCCAAC
AACTTCTGGAATAGATAGTTGCCGAACGGGTCAACCATCATCTCAGCCAGGTGCTCCAGCGACTCCTGGTAGATCACCTCGCACAGGTCGGCACGGTCCT
CGTAGTCAAGTTGTTCCTGCAGCAGCCGACAGCCATTCTGATCCTTCGACATCGCGAACACACGGTTCTGGATATCTTCCACGCTCAGTGCGGCACTCAA
GCTCGACGGGTCGTTAGCAGAGCCGCCCATCATCGGCGAGCTCATACTGCCGCCATTCATCGAGCCCAAGCCCATGCCACTAACGCCAGAGCTTTCCGAG
CGGTAACTCATCCGAGACTGCTGCCGTCCTCCAAACGCTCCATTGAGCTGGTGCCCCATGTCATCGCCGCTCATCTGATGGCGCTGCTGCTGCATCATGT
GCGACGGGGGAGGCGACATCATCATCCGGCTTTGCTGGTACATCATCGAAGAGTTCTGGCGGTTTGAGCTGTGACCGCCGCCCATGTGCTCCGGAGTTGG
GGCTCCCGCCTGGTGAACAAACTTGCACTTGCTACCCATTCGACAGTGTCCTTGCAGGAAAAACTTGCACTGCTTCATTCCCATCTGCATGCCTCCGCCC
ATTCCCATGCCCTTCCGAGGTGAGTGCGGGGGGGATGACTCCGGAAGAGGCGGCGTCATTCGCGAGTACATGTTGCGGCTCGACGAGCGGCTATTCGAGT
GGCCTCCGCCACGCATTCCCATCTGAGCCTGCTGCTGGGAAGCATACCCCATCTGAGCGTGCGGGTGCCTCATCGGACTCGAGCGCGGGTTCATGTACAT
GTTGTTTCCACCAACGTCGTACATGGCAGCAGGAGGGTGCGGCCCCACAACCATCGGGTTCCACTGGCCTGAATTCATCTGCGATCGAGACGGCGTTCCA
CCGTAGCCGTACGACCCGTTAGCAGTCTGCGGCGAGCGGTACTGCTGCTGCTGCTGCTGCTGCTGACGATACTGTTGCTGCTCGAGGGCATACGAAGCCG
GCATTTGGTTGTTCCCGTAGTAGTCGTGCATTTGCTCTTGGTACATGGCGTTATTGTCCCCCTCTTGGCTGCCCGACCAGGAATCTTCCGACGACATGCG
CGGGCTCAGCGTGTACGCTCCGCTGTACGAGCCAGCAGGCGCAGTGCTCGTGCCTGGCACCGTGCTCGAACGAGTGAGCGACAGCGACGTCGGCAGATGC
TGCGGAGCCTCCCGTCCACCAGATCGGTAGCGTTCCTGCTGCGGCGTGGCCGACGCCGGCTGTTGGTGGCGATAGCGCGCGTACTCGTTGGGCGACTCTG
GCACCGCGTTGAGCTGGAACTGGCCCGACGCGTACGCGCCGCCGCTCCCCGCCGCACTGGACGCGCTTGCAACGCCATTGGCGGGGCGCTCGTTGGCTTG
CAGACTCATCTGGCGGTCGTCCAGACTCAGCTTGAGGAAGTCCCCGCCCAGCGCCTGGCTTGGCGACTGCGACAAGAACATCTCGATGCTGTTTTTGCGG
CGGCT