Description :
From Genome Similarity Track
Location :
Scaffold_26:188509- 193599
Transcript NameFunction/comments
Phyin_T30-4PITG_12345Putative uncharacterized protein
Phyin_T30-4PITG_12346DNA replication licensing factor MCM3
Phyin_T30-4PITG_12347Putative uncharacterized protein

Sequence
5090 bases(100 bases per row)
CTTCAGCATGTCTGATAATTGAACTGAGGTGTATCAGATAGTGAGTACACGCATTGTGATCGCTTGATACTGTACACTAAAGGCAAAAGGTTAATAGTTG
TCTGGGCTCCTGCGCGTCCAAGGGCTTTAGACTGAAACCGCGTGCTATTCCTGCTCGAGTTGCAATGTTGACAGGTTGTACTCGAGACTAAAGCGCTGAG
TCACATTTACACGCGCTGAGTCACATTTATACGCGCTTTGCAACCATTATTTGCGAGCGATGGAGGATGTCGTCGACGCGTCGCTCGTACCCGACGAAAA
TGGAATTCTGGATCTGCAGGACAAACACTGGGTGACTCTGGATGAAGTCGTGTGGACCTACGCACACGCGCTGTTGGTGCTCAATGTGTCACGTAACCAG
CTCGTACATATTTCCGAATCAATTGGCAAGTTGGAGCTCCTCCGTGAGCTGCTGTTGGCCAACAACCGCATCGTCTCTATTCCTGTACAGATCGCTCGCT
GTGTGAATTTGCGCAAGTTGGATCTCCACCGCAACAGACTTGAGCAGCTCCCCCGTGAGTTGCAGTACTGCGAGCGACTAGAAGATCTCGATGTGTCTTA
TAATGACCTTTTAACGATACCACCGGAGCTCGGACGACTGCAACACCTGCGCGTACTCAACGTACGCTACAACAAGCTCACGCTACTGCCACACACACTA
TGCGACTGCCAAGTACTAGAAGAAGTATGCTGCGAGGGCAACGAAGGCCTCACAGATATCCCTGAGTCATTACGCAGCAATACAAAACTGGTGTTGTGGA
TCTGTAGCACCGTCAAGCGGCATCGCGCTGAGGTGGCGGAGCTGGTCGAGATCAACAGTGAACTGGAGCGCATGGCGCGACTCGGAGACGAAGAGCGACT
GAAACTTCGCGAAGAGATCAGCGACTTGCAACGTAAGAAGAAGAGTCTAGAAGATGAGCGGCCACATAACTATCTGCTCGTTAAAAAGCACGTGGTGCGG
GTCACGTCCGAGGTGTGCAACTTGATGTAGCCATCTTATCACGCGTCACAGATTTGTGAACACCTAACCGCTGCATTTAAAATATGAATCCCGACCAATC
AGCGCGGTTCTTTGTCGTCACTCTTTATTCTCCCTCATTCCACTGACATTTCGTTTTTGAACGAGGGGAGAGGCCACTCGATATTCGCGCGCGCGGGAGC
AGAACGACACCATGGAGCTGCAGCAGGACGCTCTGGACGAGGCCTTCCGCCGCCACAAGCAATACTTTGAGCAGTTTCTCGAGAATGAAGTGCGTGTGCA
GTGCTAATAGCGTTTTTTTCCGGTCTTTTGGAGCGCCGTATTGACTTGTGTATCATTGACACATTGACACAGGGTGGTTATGGTAATTACCCCGAGAAAC
TGAGCAGTATGATCCTCAAGAAGAGCACGCGATTGGTCGTGAATCTCAATGATCTCCGCGAATACGACAGCTCGTTCACGGACCCGGCGGTAGGCGGCCA
GGACAATATCGTGAACCGCTTACTGCGTAACCCTGCCGAGTTCGTACCTCCTTTTGAAGAAGCAGTAAAGGAAAAGGTCTTCAATATCAACAGTCAATAC
GGAAGCAAGGAAGCAGACGCATCGAAAGATATGCAGTTCCACGTGGGCTTCGAGGGAGACTTTGGCCACCACAATGTGAATCCTCGCGGACTTTTGGCTT
CATATCTCACTCAAATGGTGTGTGTTCACGGTATTGTCACCAAGTGCTCAGCCGTACGCCCGAAGGTCGTTCGCTCTGTGCATTACTGCAAGGAAACCAA
TGCTATTCTATCCAGGGAGTACAGAGACAACACGTCCATCACAGGAGCTCCAACGTCCAGTGTCTATCCGACTAAGGACGAGAACGGCAACTTGCTGGAG
ACTGAGTTCGGGCTATCCCAGTACAAAGACTACCAGATGATCAGCATGCAGGAAACCCCGGAGACAGCGCCTCTGGGCCAACTTCCTCGCTCATGTGAGG
TTATTGTCGAGAACGATATTGTGGACAAGTGTAAGCCCGGTGACCGTGTCCGAGTGATCGGTATCTACCGTCCACTTGGCGGTAACAGCACAGCGTCGTC
CACTGCGGTGTTCAGGACAGTTCTCATCGCCAACAACGTCCAACTCATGGGCAAAGAAGTGAACGGCATCGTCATGCTACCTGAGGACTTGAATAACATC
CGCGTGTTTGCTGATCGTGACGACGCCTTTGAGATGTTGTCACGCTCGATTGCGCCGTCTATTTACGGCCACGCAGAGATTAAACAGGCGCTGCTGCTTC
AACTACTCGGCGGAGTGGAGAAGAACTTGGAGAACGGCACACATCTCCGTGGTGATGTCAACGTGAGTTGGTGTCTACTTAACAATTGATTGCTACTTGG
TTACTAACCTATAATGTTACAGATCTTGATGGTGGGAGATCCGTCGACGGCCAAGTCTCAGCTGCTGCGTTTCGTGCGGACGATCGCGCCTCTAGCCGTC
AACACGACAGGTCGTGGGTCCTCCGGTGTGGGTCTGACAGCTGCGGTGACGATTGATCCCGACACGAAGGAGCGTCGTCTGGAAGCTGGCGCCATGGTGC
TGGCTGATCGAGGCATCGTGTGCATCGATGAGTTCGACAAGATGAGTGAGGCCGATCGTGTGGCCATCCACGAAGTCATGGAGCAGCAGACGGTGACTAT
CGCCAAGGCAGGTATCCACGCTACCTTGAACGCACGTTGCAGTGTCTTGGCAGCAGCGAACCCCGTGTACGGCCAGTACAACAAGAACAAGAAGCCGCAA
GAGAACATCGGACTGCCGGACTCTCTTCTGTCGCGTTTTGACCTGTTGTTCGTGGTGCTGGACCGTCTGGACCGCGGCGCAGACCGCAACATCTCGGACC
ACGTGCTGCGTATGCATCGGTATACTCGTCCGGGCCAGGAGGGCATACCGTTGTCGTTCGAAGTGAGCTCTACAGACCACATGGCACTGATCGATGAGAG
CTCAAGTGGCAGGACGGACGGGGCCAAGAAGAAGTCGATTTTTCAAAAGTTCGACCCTCTACTGCACGGCGGGTATCAGTCTGCGTCGTATGCTGGCAGT
GGCAACGGCATTCTGACGCTAGACTTCCTCAAGAAGTACATTTATTACGCTAAGACGCGCTACCAACCGGTGCTGACAGACGGAGCTATCGAGCTGATTT
CGGAGGGGTACGCAGAGCTGCGGTCGCAGCAGAACGCGCGAACTTTGCCCGTGACGGCGCGTAGTCTGGAGACGCTGATTCGTCTCGCTTCAGCTCATGC
CAAGGCGCGTCTCAGCAAGACAATCGAAGCTGTGGACGCAGAGAAAGCCATGTCGCTCATCAGCTTCGCACTGTACCACGACGCGTCCGAACACTCGAAC
GAGGTCACAGCTCCGACACCAGAGGAGACACCGGAGCTCCCTGTGGCGGGCACGCAGAAGGCATTGGCAGAGCTGGAGATTGAGACGCCAGTGACGCCGG
ACAAGTCGAGGAAACGCGACCGTGGAGCATGGAGGTACGTCGCTGTAAGGTTTCTGTTGTGCTGTACAGTGTTGCTGACTTGTGCTTTGTTGTGGCTACA
GTACTGCTACCCTTGCGGACGACGTGCTGAGTGTGTTGGCTGACATGGGCAGCGACGCCAACGTGGACGACGAGAACGACAGTATCAAACTGACGGACAT
TCTGTCGCGACTAAATGATGGTCGATCCAGGGGAGACGAAGTGCCTCGAGTCGAGTTAGAAAAGGTCCTGGTGGATCTGGAAGAGCAGAACAAGGTCATG
TACATCCAGGACGGAGACCCGATGGTTATGCTCATTTAGCAAGCTCCGTGGATCACTCTGCTAGGCTATGAGGTTTTATATTTTGGTTCTGGGAAGAAAA
ATTAATCACGCAAAGACGTATTCTGTGCAGTTGGCTTGACGGATTCACGAGTTCTATAGCTTTTTGTCTTCGTCGTCCTCCTCTTGGTTGTTGTACTGAA
TCAGTGTGACGTCCACGTAGTCTTCCATGCTGTTAAAAGCTGTGAAATGGCTCCATGGATTCATCTCCGTGCTCTCTGCTGGTTTAGTGGCTGCATCCTG
CTGTGACGTCGCTGTCTTGACGCCGTTCTTGATCTTCTGCGTGTGCTGCAGCGACCTCGACGCCTTCGTCGAGAGTCGCCTTGCCAACATGGCAATTAAA
AAAATGAATATTAGCCAATCAGTGAAGACACCATCAGAAGGTGCGTCACGAAGCGCGTCATCGCAACATGGATTCAGGAGGGAAAACCTTTATAAAAAGC
CCAACTTGTTATATCTGATTCCGGAGGTAACCTTTAAAGTTACGCGCTGTTTCAGCAACCCTCGTATAATCTATTTCTTTTCATATTTACTTTTCCCTTC
TCTGTGACACCGACATAAGCTGCCCGCGCTCATTTCACTCCTCAAGATGCTTGCAAGCACCCTCCGCCGCTCCAGCGCTCGTGGGCTTCAGCGCAACAGC
CTCCCCGGCCGCCGTGTGCTCTGCTCGGCACCAAAGGAGCGCACCTCGAGTGCTGCCATCCCGCTCGGCGTCGGGGTTGCCACCGGTACATCAGCCACAC
GCGTCACTCGTGCTCTTTCACCCGTATCCTGACTGGTTTGTTCTGGCAAACTGCTTGTCAACTGCAGGTGGCGTAGCTGGTATGGTGTCAGCACTCACAG
GCGTCGGTGGAGGCATCATCCTCATCCCAGTGAGTCGTTAAACCAAGCTGATCTGACACGCCGTGCAACAGCCATACTGACCTTCTTTTCACTGGTAGGC
GATGGCCAAGTTCACGTCCTTGTCGCAGCAAGCCATCAATGGCACCTCACTGGGCGCTGTAGCCATCGCTTCCTCCGTTGGCGCTTGGAATTATCTCCAA
TCGGGGTTATGCAACGTGCCACTAGCGCTCACGACAACTATCCCTGCTATCCTCGCCACCAAATACGGCGTTCGCACTGCACACCGTCTCACCAGCAAGA
AACTCTCGCTCGTAGTGGGCTCAGCCATGCTCCTCTGCTCTCCTCTCATCTTCCTCAAGAACAGTCCATACATGCCCAAGTGGAGCGAAG