Description :
From Genome Similarity Track
Location :
Scaffold_1098:1885- 3749
Transcript NameFunction/comments
g16808.t1XP_009532708.1 hypothetical protein PHYSODRAFT_249081 [Phytophthora sojae

Sequence
1864 bases(100 bases per row)
AAACCTAGATAAATGAACCAAACGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCAAATGAGAG
GTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGTTATGAAT
GTGGACCACCCTGTGGTGGTCACCTGAATGTGTGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACACAATCCCCCC
GTTAGGATTTGACGTGCCGGTCTCGACACGTCAATCCGTATTTTCTTCGGGAGAACACGTGCTCATTCCCAATGAGCACCCCAACGACGTCTTCGTCCAA
GACGCCGGCCGCTTCGGCAACAGCAAGTGCTGTCGTCGCCTCCAAGGCGACGACGGCCGCTGCCTCAGCCACGACCGCTACTGGCATCGCCTCGACGGCG
ATGCCGACAAGCGCGGCAACAGAGAGTCGCCTCTCTGTTGCTGGATACCACTCAAGATGGCATGAGAAACATGCCATCCGAAACAAGACAGGCAAGATCA
TTGCTGTCGAAACCGGAGTGGGTATCTACTCTCCGGGTGGAGAGGGAGTTCCCCTCGACTACGGGAGTGAAGTCGAGGAGGGGGAACTCGAAGGAGACAA
GGACACCTTGTCTCCGGGCCACACTGACCCCAATGTGGGTCTGCGTCGTCCACGCGAGGACGACCCGAACGCTTCGGGATCGAAGCGTTCGCGCAGCGGC
AGTGGAACACCGCTCGCTGCCGCTGGAGCCTTAACGACTCCGCGGGATGGAGATGACTCTGCTCCATCCGCTGTTGTTGCGGCCTCGCGCACTGAACCAG
TGCGTGAGCCGTGGATGCCGTCTCAGTCTGAGATCGGCAGCCGATTCGGTGCGACCGCGCCACCGAATCTGTATGCGCTGTACTCGTGCAACGCCATCGT
TGACGATGACGTCGCGAAGCGAGTACACTTTGATCCGTTAACGAATCAAAGGCGCGACTACTACATCGGGCTTCTCCATGAGCTCCGATGGTTTGCGAGC
AAGAAGACTTCTCGCAGAAGCAAAGTGCCCGAGTGGCAGGCACTTTGTCAAAGTTGGAGTGCCTTTGTTGAAAACTTCAACAAGAACCCCGCTGGCTATC
GCGACCGGATTACCAGGCGCGGGAGCGCTACGAGAAGTTCTCGAAGCGTGGTAAACTTGAACGACTGCACCATGGTGCAGTCGGTATTGGACTTCCTTGT
GCAGTGCCTTATGACACTGCTTGTGAGTACTGCTACCCCGGAGCAGTACGCATCACCGAGCGGGACGTCAACGGGTACACGTCCATGTGTGTACCTGACG
ACCTCAAGACCCTGCGCGCCAGTTTTCAGGCGCAGGCGTTTTCTAGTGCTGCGGATATTCGCAGCACTTATCCGAGTGCTGTAGGCGACTACAGCGCTCG
CCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGAATGTCCTCCATCAGGACATTCCGTGATTCCCACG
TATCGTGTTGGGGAGGAAATTCTCTCCAACGAATACGAAAATGAACCGGACCTCGGGTCTGGTTCCGATGACCAACAATTCGCTGGACGATCCAGCGAGT
TGCCCCGCGTGCGTCTCGCAACGGGGGTGGGGGGGGCGGGTAGACGCCCCGGGTTTGGTCAACCAAATCTTGAGTCTCGCTTGGAGGCTGTTGAGCGTCT
CCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGTTAAAGGCTCAGCTCGCGGAG