Description :
From Genome Similarity Track
Location :
Scaffold_202:1885- 3101
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_202-fgenesh-gene-0.6Conserved gene of unknown function

Sequence
1216 bases(100 bases per row)
CTGGCTGACCATTCCCACTGTGGGGCAGGGCATGATTCATGAAGCCGGATTCACCCAACAACTCCACCGAGCCACTCGCAACTAAACAGCCTCAATATTG
AGACGAGGACTGCGCCGACGACTTGGGGATGTGAACGCTTGTTGATAGTAATTTCTGCGATTCGTGTGATGGCTGGGTGCGAAAAAaCGCCTTTtCAAGT
AACACGTAACATGAGTTCCCTGGTCTCCGGTCTTTCctcGTTGAAAATGGCTGTGCAcgATGAGATCATTTCAACCTCCCGTAATGAACGAACATTGCTT
TCAAGAAATCTCGAAGGCACAGAAAGGGGTGATGCTGTCcTACCCAACGCACTGCCATTCCCATAGTCTGTCGATAACACACTCCATTGATATGGTAACA
GGCCATGAGCTACAACTACGCCTCTGCTGCTGCTTTAGGaTCGCCACAACCTTTGGTCACGAGTTTCTCGATCACGTCTCCAACTACATGGTTGCCGCCG
ATTTGCCACGAGTTCTCCATTACCaTCACCGCgaTATCGAAAATGTTGCGTCCAACATCGAGCTCGTAGTGATGACTGAAGGCGTAGCCAACATCCTGCA
GCGATGTGACGTAAAACTGGCACGACGATGCCATGAATGGTGCACGACACACGTAGAACAAAGATtCGACTTCCAATGGACCCTCCCGTGTGTCGAAAgC
AGTGGAGTACGGGTAGCGACCCACACTCGAGACGTTGACGTCTGCGATACTGGAGAACTTAACTGGGAATTCCTGCGGCAACGATGGGTCTGACTCACGG
TTGTAGTGTTGATCGAGCACGATCATGGGCATCGAGACAACTGGGAAGTTGCCGATCATATCGATGGTTtGCTGCTTGGCACAACGAGCCAAGTCCCAGA
AGCCTTGGGTTGGGACGTGCACACCcTTTTCGtGCAGAGCTGGCATCAGAGTGGCCGTCGCGTAGCagCCGATAGTCTCAGACGAAATCGGCTTCGCTAC
TCGCTCACGCATGTTAAAATTCATCAGCACGTACAGCTTGAACGCCTCGTCGTCGAATGCGTCGGTGTGGTAGATATAACTCACAAGAATCGCAGCTGTG
AGGGCCCCGAAAAACGTCGTGCCTTCTTCTCGGCAACGAGACAAGAgCTTGTCCAGGTTTtCCTTCGAGCCTCTTGCAAAGAGAAGAGTGGCTtcATTGT
CTGGTGGaTTAGGGAG