Description :
From Genome Similarity Track
Location :
Scaffold_34:18847- 20208
Transcript NameFunction/comments
Phyra_78701poly [ADP-ribose] polymerase, putative

Sequence
1361 bases(100 bases per row)
GCAATGGCGTCCGGGTCGAAGTACGGGATCTCACCGTGCGGTGTCACACGCACAGCGTGGCGGTTGCCCGGCAAGTAATCGAACGTAGCGTAATGAACCG
TCGAGCGGTTGTCCCAGATAGCCACCGAGTTCTTCGTCCAGTGAAAGCGGACCTGGAATTCGTGCCCTTCCGCAATGTGCTTGTAAAGGAACCGCAATAC
CGCGTCTGTAGAATGAAAGTACAAACAGGTTGCTATACTCAGTACCCTTCACAAGCATCCTGTGGTGGGGGCCAAACACGTACCAGACTCAGCAGCAGAC
AGGTTCTTGATGCGCTTCGTGAACCCGGCATTCACGAACAGAGCCTTCCGCTTCGTCACAGGATGAGTGCGCACGACAGGGTGCTCGAATTCGACCACCG
GCCGGCGAACGATACGTCCAGCCTTAATTGCATGTTCGGCTTGGCTCTGTAGATAACATACACAGTCAGTGAGGTTTAGTTTTCTGTGTGTGATTTTTGT
TTTGTTTTTTACAGCAGCGAGCTGCCGTACCTTGCCACTGTGCAGCGCAACCAACCCTTCCACAAACTTTTGAAACGCTGGGGTGAGGCGATTGTATGCT
TCGTAACCGCAGGCCCAGAGCGTGTCACCGCCCACATCGGGGCTTGTCAGGACTTTGAAGAGCGTGTACGATGGCGGCTACAACAGAAAGCAAATGAATT
AGTAAGCGATGGTTTCCTTAGCGATTCGCACTGCGCCACATTACCTGGCGCTCGTAAGACACGTCCGTGTGCCAAGAGCTCACTGGGTCATAGTAGTGGT
GCTTGAGCACCTTGTCGCTTGTCTCCACAGAGTTCTCCACAACTAGCATTTCGGGGTACTGCTCCGTGTGGGCTAAGTTCTGTTGGATGTGGAGAGGACC
GTAATAGCGGCCAAGTTCAAGCTGCTGCTCGGCCGTGATCTCCTGCTCGCGGAAGAACACCACGCCGCGCTGCGCCACCAGCAGCGCCAGCTCGTCCTTC
TGCGCGTCCGTCAGCTCGTGCAGCTGCAGACCCGAGATCTCCGTGCCAATCTTCGGCTCCAGGTGCGTCACCGTCGCATCCGCAAGCAGGTTCTTGAACG
ACGGGTCGGCCTAGAGCGCGCGGTCGTTGTACGGCAGCACGGGGATCGGATCGTACGTCGTAGGAGGGAAGGTGCTCAGCAGCTCAGGGTGCTCGAACTT
GGGGTGCTCGACCTCTTGGTTGAGCGCGTTTTTCACAGGTACAGTGGCCTTCGAGGCAGAGGTCTGCTGGGCTTCGGCCTCTTGGTTCTGGGGTGCCATG
GTGAGTGTTGATGTTGCGCACGCGTCGACAATTGGAAATTGAGGTGGGGTCGTCCGGGGGA