Description :
From Genome Similarity Track
Location :
contig_39:188442- 190390
Transcript NameFunction/comments
g8537.t1XP_009528031.1 hypothetical protein PHYSODRAFT_332693 [Phytophthora sojae
g8538.t1hypothetical protein
g8539.t1XP_009528033.1 hypothetical protein PHYSODRAFT_351401 [Phytophthora sojae

Sequence
1948 bases(100 bases per row)
CACGTTTGTCGTGGTGGAGCTGGCCGAGCTCGGCAACGAAGCTGCTGTGTACGGCCTGCTCACAACCGTAAGTAACCTCTCAAGCCCGTTCGCCTCCTGC
ATCTCCAAGAACGTCAATGCGCTCTTTGACGTGGGTGTGACCGACATCATTCACGACTCCAAGCACGTGCGCTGGCAAGTCACTTGGACGTTCGTCATCG
CGTATGTCATGAAGCTGCTGTCGCTCGCGTGGCTGCCTCTGCTTCCGCCTCAAAAGCGCGAAACCCAAGAACTCAAGCGACGAGCTCGGTCGTGGTTCTG
GGGCGGCGTGGCTACCGTCGCCATCTTCACTTTTGCTCTAGTATGGTCTGTCGCCACCAATCTCCTCTCCGTCTTCCCCAACACCGCCTGCCTCGTGCTC
GCCGGCGGTTCCGGGTGCAAGTAGCCTGCCTTGCTGCGACCATGTTGAATACTTTTATGAGCCACGCGTTCACTTATTTTTATGTCAGACGGTAGCACTC
AATAATCGCTTTTCAACCAATCGCGACCATCTATCGCACACACCATCAGAACCGACCGATCCACATCGAGCAGCTCCGCCAAGATGCTGCGCTTCCTGTC
CGCCCCCGCCGTAATGAAGTCGGCGTTGCAGAGCCGCACGCGTGCGCTGCAGGTCGTGGCTCGCCGTCCGGCCGCCTCCTCGCGCAGCTTCACGTCCACG
CGCTCTCGTCTGAACCCGGAAAAGGTGACGGATGTGGCATTTTCGAGTATTTCAATGCAATTATTACGTTCTAATGCGGAATTATTGCGGTGGTGAATTG
CAGCCGGCTGCGCAGGCGACCAAGGAGGGACATAAAGCACCGGACGCACTGGTGCTCACACCGTACGAGAAGGTGACGGCTACGGCCACCGGCGGCTTCT
GGCTCGGCCTTATCGGTCTCGGAGCGGTGGGCGTCTACTTTGTCGCCCGTGAACTGCTGCCCAAGTACGTGGTTGAAGGTGGTAAAAGTGAGGAGAGTTC
TGACGGATGATTCTGGTTGTTGTGCAGCCGTATGAGCCCCAACGGCCTCTTCAGCGAGTCGCTAGACTTCCTCTCGGAGAACACGGATGTACGTGAATGG
AAGATGCTGTGGTGGGGCTATAGGAGCTGTAGACTGATGGGGTTATTGGGTCTTTGCTGCAGGTGACGTCACGTCTGGGCCTGCCCATTCACGGCTACGG
CCACGACCACGGTGGCCACCGTGAGGGTCGTCGTAACCGCATCGAACACGTAAACCTCCAGGGTAAGGATGGCTCCCCGCGTCTTCGCATCAAGTACAAC
ATCAAGGGCCCCACGGGTCACGCCTACGTGTTTGCTGAGGTAAACCAGAACATGAAGAAGAACGAGTACGCGTACCTCATCGTCCAGGTGACCAAGACCG
GCGAGCTGCTCAAGATTATTGACAACCGACAGATCCTCGCTGCAGACTCCAAGGAGGAGCAGGACGCTCTGCGCCAATTGCTCGGCAAGTAAATGACCAC
TCATTTTTGCGTGAGCGGGACCCCAAGCTTCCTCAGGTGCGGGATATTCTTTGCTTCGAACCGAAGCGAAACTTAAACAAAGGAACCCTCCTCTTTCCAT
TGGAGTGGATGTCTGTAGCCTGCGGACGGTGCACGTGTTCTGTCTTGGATCATCCTCTTATAACTCGGCGGTGTCTACTCGTTGAAGCTTGCTATTGCGT
GCTAGTAATAACCTTCTCTACATGTAGCAGCGTACAGGTGCACTACTCGTCATAAAGGAAGGCATTCTGAGCTTGGTCTTTGCGGGACATGTCATTCCGT
TTGTTCACAGCCTTCGCCTTGAGGTCAGCACGACGCTTTACCGTGGAGCCCAAGCTGATCTTCGCATTAACATTCTCTGTGACTTCGAACACGTCGCGCA
GCACCTCGTTCTCCACGAGGTGGGTCTGGAAACCAGACCGTAGCGCAC