Description :
From Genome Similarity Track
Location :
Scaffold_41:18844- 19850
Transcript NameFunction/comments
Albla_Nc14039860kinesinlike protein putative

Sequence
1006 bases(100 bases per row)
ATCGATCCTTCACATACGATTACACCTTCAGCAAGTATGCGCAGCAGTCGGACATTTGGAAATGCGTGGAACCTCTTGTTCTATCCTTTATGGAAGGCTA
CAACGCCACCATCTTCGCATACGGTCAAACTGGATCAGGAAAGACGTATACGATGGGAACAGGAAGCTGTACTCACTCCCTTAAAGAAGAATATGGAATT
ATCCCTCGAGTTATCGAACAGATTTTTCAAGACATCAACATGAAAAGAGAGAGGTTATCCGATTACAAAATCACAATGCAAATTCGATTCTTAGAGGTAT
ATGGGGAAGAGATCCGCGATTTGCTTTTTCATGCATCCCCGTTCACAGACTCCAATATGGAGCTTTACACCGAGAACATGGCTACAGAAGGCCGATCCAG
CAGTCATCAAAGTCGCGTCATCTTACGGGAAAGTGAAAATGGCGAGGTACAAGTCATTGGGGCCGCCGAAGAAGCTGTCACTTGTGTGGATGATTGTTTC
CGCTTATTGGAACGAGGAACGCTTTCCAGGACGACGGCAAGTACTTTGATGAATGCCCATTCCAGTCGATCACATGCCATTTTCACAATCACGATGACAC
AACATATTTCAATGGATAGAGATTCAGAATCAAACGCTGCGGAAGAGGAAATGAAACGAGAGACATTATTTGAAACACGCACATCGTATTTCAATTTTGT
CGATCTGGCCGGCTCTGAACGTCAGAAACGAACCCAAGCGGAAGGAAAGCGATTGAAAGAAGGTATCGAGATCAACAAAGGCTTACTGGCGCTTGGGAAT
GTGATCAGCGCTTTAGGCGATGACAAGAAGCGTGGAAGGGCTCACATTCCTTATCGAGACTCCAAGCTAACACGGATGCTGCAAGATAGTTTGGGCGGAA
ACAGTAGAACACTCATGCTTACGTGTGTGAGTCCTGCAGATCTCAATTTCGAAGAGACTTTGAATGCACTCAAGTATGCGAATCGCGCGCGAAATATCAA
AAACAA