Description :
From Genome Similarity Track
Location :
contig_63:188437- 189977
Transcript NameFunction/comments
g9449.t1hypothetical protein

Sequence
1540 bases(100 bases per row)
TCCTGCGTGGCGTGAGAGGACGGGGGCGGGGGAGCTGCACCTTCCTTCCTGGACGTCTGGGGGCGAATGCGAGGAGCTACGAAAGGGGGGGAGGGATTCG
GTAAAACCGGTGCGCATCCTGCTGATTCGCCAGGACCATTTTCAACCGCGCTGATTCGCAGAGTACCAATACCAGTGAAGTACCGGTACGCACGTTATCT
ATTCCATGTGGGCCACAATAATAATGCACAATTGTTGATACCGGTGAATAAAAGGCTTACTTTTTCTATTTCGGATGCGCTACCGGTGCGGGAACCCTAT
TCCCGGTATTGCGTGGACCAAAACTGCGCCGAGCGACTTGACGAAGCCCAGTAGGGAGAGCACCAGCATGACGCCGGCGCACGCGCTCCAGCTTGATGCG
GCGCCCGAGGCCAGCGACTTTTTCTTCGGGAATGTGCTGGGCCAGGGATCGTACGCCAAGGTGAGCCGTGTTATAGCCGCCGCTGCTGCTGCTGCGTGGG
CTATTGCTGACTTCGTGCCCGGCGGTTTGTCGCTCTCGCTGCCTGTTGGCGCCGCTTGCAGGTTTTTCACGCGCAGATGAAGAAGAATCACATGGACTTC
GCCGTGAAGGTGATGGACCAGAGCTTCATCCGCAAGGAGAATAAGACAGCGTTCGTGCTCACGGAGCGCAAGGTCATGTCGCGCCTCTCGCACCCGAACA
TCGTCAAGTTCTACTGCAGCTTCCGCGTAAGGCGTCTGCACTCTGGATGCATTTACTGCGCATGGCCTCAAAGATGTTGAAGCCAAGGGCAGTGCAGCAC
CGCAACCGCAATCCATCTGGTCTCCTCGTCTCATTTTTTGCGTCCAATTGTGGGTACAGGACCACCACAGCTTGTACTTGGTGATGGAGCTATGTCGCGG
CGGCGATCTCTTCGGAGTCATCAGGTGCGCGCAGCCTGTTCATTGTTCATGCCGGGAATACGAGGGTGCTCATTGCAGTGCGTTGTGACCAGCAAGGAGT
ATCAGAACCAGCAGGAACAAGGCGTTTCGGACGCTGCGTGCTCTTTCGAACTGACGCAATTCTACATGGCAGAGCTAGTCAACGCGTTGGAATATATGCA
CTCCCAGGTACTGCGTCAGCAAAGAAGTCGTTGTTGTGATTGTATGCGATACTAATGAAGGAGAATCCTGCTGCAGCATGTTATCCACCGCGACATCAAA
CCCGACAACTTGCTTCTTAGGTACGGTGCACTTTGAATTGAAGACAGCTACAGCCTCTGCATCGTAAATCCTAACGACTTCTTGTGCGGTCCCGTTCAGT
GAGGATGGACACTTGAAGGTGACTGATTTCGGCACGGCAAAGGTAAGGCGCCCTATTCAGTGAGCTTTTCTTCATGAAAATCGCGTTGATGTATTCGTTC
TAAACGCTAGTGTTGGCAATACAGGACCAAGATGGCGAAAGTAGCGATGCGTGTCAGTTTTGTGGCACTGCCTCCTACGTGTCACCAGAAGTATTGCACG
ACAAGCCGGCTTCGCGAGGGGCCGATCTCTGGGCAATGGG