Description :
From Genome Similarity Track
Location :
Scaffold_79:188383- 189782
Sequence
1399 bases(100 bases per row)
GTTGAAGTTCTCAACAAAAGCATTCCAACTTTGACAAAGTGCCTGCCACTCAGGCATTTTGCTGCGAGAAGAGGTCTTCTTGCTGGAGAAGTATCGGAGC
TCGTGAAAGAGTCCGATACAGTAATCGCGCCTTTGATTCGTTAACGGATCAAAGTGCTGCTCCTCCGCCACAGCATCATCGTGAATCCCGCTGCATACGT
ACAGCGGAATTTCATTTGGAGGCACGGTGTTGCCCACACGGTCTGCGATCTCTGACGCAGACGGCATCCACGGATCGCGCGCTGCTCAGGCAGCGCGCGG
AGAACTTGTAGACGCCACCTCACGCGGGGAGCTTAAAGCCCCAGCAGCGGAGAGCGGAGTTTTGCTCTCGCCGCGCGAACGCTTCGAGCTCGAAGCGTCC
GAGTCGTCTCCTTCACGAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTATCACTGTCGATAGACTCCTTGCGCTTGTTGGAAGAGGGCGAGGCCTCTT
CCATCTCCACGTCGTCGTCTTCGTAGTCAACGGCGTCGTTGACTACAGAGGAACCTTCGAGGACAATCTCCGACTGAGTTGTCCCCGACGCGGCCTGTGC
AGCGAGCGCGTCGCGCTTTGCCTGCTGACGCTAATGGTACTGAGCAACAGAGAGGTTACCCTCTGTTGCGGCGGCGGTCTTCTTCTGCGGCGAGCTCATT
GCGGAATGAGCTCGAGTTTTCTTTCTCCCAACGTGAAGAATTGACGAATGGTCATTTTCCTGATTGACGTGCCGTGACTCGGCGCGTCTAACCTTGAGGG
GGGGATCGTGTAACCGGGTTACACGCACAAGTGGCTACAGTCACTTGTAACTCTAACAGATACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACCTT
GGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTCTTAGCC
AATGAGCGACATGCATAGCATTGGAATTCTGACAACCAGCCGTTGGCAGATTCCTAGTTTAGAATATTACATTTAGAGGAATTCAGAAACATAAAACAAA
AATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTCTTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTACCTCTAATTTAAACTA
AGCTACGCTTCCTCACATTCACGCGCACACGTGTAGGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACAGTACTAAATTGGTTATTTTGGATTTGGTCCG
AAATAGTGCAAAGACGCCATTGGCCGCTGTCCTCAGACAGAACACGCGCTGGTCGTCGACCTTTTCACTGCTCAAGCGCTATTTTCGTCTCCGTCCGTT