Description :
From Genome Similarity Track
Location :
Scaffold_66:18836- 21357
Sequence
2521 bases(100 bases per row)
GTTGGGCGTCGTGGTAGAGAGAATACATATCACACGGTGAGCCGCGACTTTTGTTGGCGCGCCAGTATCAGTTCGTGCGTTCGAGCCTGCAAGTTCTGTC
AATGGGTGAAGTCTAGTCCTACCCTTCGTGCCCCGTCGCAGCCTCTGCTCACCCCGGCAGAGTGCTGGGAATTCGTTTCCATGGACTTCGTCTTCAGATT
CCCTGTAGATCCACACAAGATTACTGGCATTCTTGTGTTCATTAACATATTCAGCAAGATGGTACATCTAATTTGATGTACCCGAATCCATCAACGCATC
GTCTTGCGCTCGTGTCCTTATCGACACGATATTCCGCCTTCATGGGCTGCCTCGTGAACTCGTGTCCAACCGAGACCCGCGGTTCACAGCTGAGTTCTGG
CTTTCCGTGCTCAGAACACTCGGAAAGCGTTTATGTCTACATCTGAACACCCTGAAACAGATGGTCAGACGGAACGCGCCAACCGTGTTCTTAAAGAGAT
CCTTCGAGGGTACGTCTATTCGTTTACGAATTGGAGCGAATTCTTACCAATGGTGGAATTCGACATCAACAACTCGGTACTCGCTTCGACGAAGCATACG
CCATTCTTCGTGAATGGCTTACGCCATCCTCTTCAACCCACATTATTAGAGTGTGACTCTAGTTAAAGGGAGGGGATTCCTTCGAGCGAACGCCAATCCG
GCTCTCACTCATCACGTGCTGACCATGAGGTCACCGCGTTCGACGCCGATGTCGATCACATCAACTTCGGTTGAGAAGAGGAAAGTAAGAGCGAGGATGC
TCTTACTCACCACGATTCTGATCGAATCAGCATCCCGCCTGGTGCGTCTGAAGACACACTCACAGAGGCAACAAGTGATCTTGATGTAGTACACTCCAAG
AGTACTGTAGCTAAAGACAGCAAGTCAGCAGATAGATTCATACTAGCTCCCAAAAAGGTTGTTTATTTTGTACAAGACTCTATTGCAGAGGTGATAGATC
GACAAAAACAAAACGCTGACAAGAGTGGAAGGGCAAACGTTCATTCATTCAATGAATGAGATTTAGTCCTATTATCTACGGTAAACCTACCTCGACACAT
AGTGACTAACGTGGGTAGGAACCAGTTACTACCCAAGTTCATCGGTCCATTTCGAGTGCTGCGCCGCCCAGGCAACGCATATACGATTGAACCGCCACGT
AAGATGCGCATGCATCCTACGTTCTACGTCAGTCGTCTTAGGCCGTACTAACAGTACGGGGCTTCATCCGGTGAAGAAAGCCCTTGTGCTCAAGCATCCC
CAACAGATACTTGTGCTCGCGATGCTGGCTATCAGCCCACGTCTGAAGCTCGGATATCTCCCCGCGAAGCCGAGAGACATCCTGACGAACTTCACCCGGC
TGGTTGCGAAGAGAACGCTTAGACCGCTCATTTTCAAGATGGGCAAAGGCAAACTGTGTTCTTTCCTTCTCCCGATCTAAGCTCAGACGGTTCACATTGT
CCAGCAAATCCAGACGCCTGCCTCTCTCGTGTTCGAGGTCCTCGCACAACTCACACGTTACGCGGTCAAGCTGACTCAAAGCATCAGGTTGGGTATGATA
ATCAGTCGGACGATGTATTTCCTTCTCCACCTCATCCAATTGGTTGATAATCGCGGCGGTCAACGCTTCTTCGTGGAACGCCTGTTGAACCACCGCGATG
TGAAAGGACTTCGGACGAGTTACGTCTTCCGATGGCGCGGCTATCCGCCTTTGGACGATAATTGGGAGCCTATCTCACAACTGATGTTGGATGTGTGAGG
CCGTGTAGACCAGTGACAAGGCAACTTTATTGCCGAAGAAGGACCACCGGAAAACGAACGCCCCGCGCGTTTGTAGAGGGACTGCAAATTAGCTATTTCC
TCGTACATCTCAGATGAGACGCGTACTCTACACAAGGGGTCTTCCATATAATACGTCTCCTTGGGATCTCGTGCCAAATTGCTTACACAACATTGGCAAG
GATCAACTGGAGCGGCATGGTAGCCCGGCTTCTATCGGTAATTGATGCAGTTTGTAACGTGCACCGAAAGAAGTCCGCTTCTCAAACCTATTGCAAGATA
AGGTCATCTTGTCAAGCCAGGCATCTTGTTTAACCTCTTCAACATTTTGGGTGAATGCGTTCCATGTCTAGACTAGTGGGGCCCTATCATCTTTGTGGTT
CCCGCTGACCATCGATGTTTGAAGAACACATCGATGAAGAAATCATGTTCAGTGCACAAGTAATCACATTAGAATCAAGGCCACGAAGTCGTGATGAATC
GAATAGTCTTATTTGATAACGATCGCTTACCGTGTCGGATAGGCGATCCAACACTCGATGATGAGGCAGTCACGCCTTTTTCTCAGGAGCGACACTCAAT
ATACCTCTATCTCTAGCTTCTTGCATGGTGTCAATAGAGGTTCCGACACTATCATCAGCACAATCACCTTGACTATAATGCATCACTGCATTACCGTCAT
CATCATTGTGCAGGCCTAAGC