Description :
From Genome Similarity Track
Location :
Scaffold_364:18835- 20420
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_364-fgenesh-gene-0.3G10
Pytap_DAOMBR444maker-pag1_scaffold_364-fgenesh-gene-0.9MMP37

Sequence
1585 bases(100 bases per row)
ATGTCCAAGTGGACCAAGAAGGGCCGCGCGCCGGCGGGCTATGACTACATCAGGCCCGTAATGGAGGCGCTGGAGAAGGAACTGCGCGAGAAAATGAACG
AGCCGCACGAGGgCAAGCGCAAGTGTGAGTCGCTCTGGCCCGTGCACCAGATCAACTGGCAGCGCAGCCGCTAcGTGTATGACATGTATTACAAGTACAA
GCGCATCTCCAAGGACGTGTACGACTACTGCATCAAGATGAAACTTGTGGATGCCAACCTCATcGCCAAGTGGAAGAAGCccGGgTACGAGCGTCTCTGT
AGCACCTACGCGATTAACACCAAGAACTACAACTACGGCACTGTCAGCATCTGCCGTGTACCACGCCATCAGCTCTCGGATGACCAGGTGATCCAGGAGA
AGCACAGCGGCTGTAGAGGGTGCGCGTCTGGGCCTGGAGGCTACCACAACATCTTCGGCACCAAGTACGGTCAGTAtcTGGCGAAGATCCAGATAGCGCG
TGAAGAGGCCGGAATGGCAGCCCGtgCAGGaGCGGAtGTTTGGGCGAAGGAAGAAGAAGAAGCGAAGTACGACAGCGATTCCGATGAgCCcGGACCAAAG
CCTCCGGCTAAGAGTGAGCGTAAGCGTGAGCGCTCGGATGACGAAGCCGAGCGTGATGGagAGTCTTCCAGCGAGAGCAGCGATGACGACGGATCAGAAG
AGGAATCGAAAGAAGAAAACCGCTCGTCAAAGAAGTCGAAGCGGGAGTAGATAGTCAGATTTACCAATCAAAAAGCCATGCCTCTACTGCTGTGAGGGCG
TATGTCTACCAAACGCCAGGCACGATAGTCCACTTGGCCAGGATCTCGCTGCGGAACTTGGTGTGATACCACTGCTTGGCGTAGAGTGCACAGATAGATT
GGTTCAGCACGACCCAGAAGAGGATGATGTtCACCATCAAGTGTGTAAAGCCGCAGACTGCAGAGAACCCGAGATAGATGACCAACTCCGACGAGTAGAG
CGGGCACAGGACGTAGTCgAaCCACCCGCCCTTTGGAACCACATGCTTTCCTCCGTTGGCTCGCTTCTGCTGCGCAAGACTGGAGTTGCAGATGTGCTGC
TGGTAGCTTCCGTAGATGAACAGGAGCAAACCGACAAGCACGAAGAGTGGgTGCACCGTGAGCCCGAGGTCAGCAGTCGAAGTACGGGACATGGGGTCAG
CGAGAACGGAGGgCGCAATGCCAaGgTAGTGAACGAGtCCAGCGATGAGCACTACACACGGATCCGTGAGTTCAAGCCatAAAGAGAAGAATTGACAGAG
AGATGGAGAGTCACGTACGGCCAACGTGCATCTTGGCGTCACCGAACTCGGTgACGAGGACTGATTCCAAGAAGCGGCGAGTGtCCTGGATACCGAGCAA
AGCGATCACCGAGATGGCCTCGATGCGAATGTAGACGGGTACGGCGGAACTCGACTCGGACTGGGGggCACGAAGCACGCTCTGCACGGCGGGGTGgTCG
GGCACTGCCACGAGCACCAACGCAATCAGCAGGTTGTACAACGCACCGGCCAGGTAGAAGTAGATCCAGCCGCTCTTCTTCATCT