Description :
From Genome Similarity Track
Location :
Scaffold_132:18834- 23689
Transcript NameFunction/comments
Physo_143207reverse transcriptase

Sequence
4855 bases(100 bases per row)
CCACACCAACGAGCGCTGGAACGCGAGGATGGCGACCGAAGTTGACCAAGAACGGGGACAGCCCGGTCGATGCGTGGACAGCGTTGTTGAGGGCGAATTC
GACCAGGGGCAGGAAGGTGCTCCACGACTTGAACGTCGTAGCGAAGCTGCGTAGTATGTCTTCAACATCACGGTTGGCGCGCTCAGTTTGGCCGTCTGTC
TCCGGATGCGACGCGGTGGACATGCACAACCGCGTCCGCAGCAATTGGAAAAGCTCTCGTCAGAAAGCAGACGTAAAGCGAGGGTCGCGATCCGATACGA
TGGAGGACGGAAGCCCGTGGTGGCGGTACACTTCGTCCACGAAGATCGCGGCGGTTTGCTTCGCTGTGATGCTGGCAGCAACAGGAGCAAGATGGAGCAT
CTTGCTGAACCGATCAACGAAGATAAGCACGCCAGTGCGCCCTTGAGCGTCTCGGGGCAGCCCGAAGACGAAGTCCATGCTGACAGACGCCCATGCGTCT
GTGGCGACTGGGAGAGGTCGAAGCGGAGCCTGCTTGGACGGATTCGGCTTCACGCGTTGGCACGCTTCGCAGGAGTACCCATTTCCGGACCCACTTGTAC
ATATGCGGCCAGTAGAAGTCTCTGGACATCGACGCGAACGTCTTCTCGCGTCCGAGGTGGCCGCCGCTCGGCGTGTCATGGAACTCGTGGATCAGCCGAG
CTCGGAAATCGTCGTCCAGAGGAACGACGATGCGCGGGGGTCTTCGCAGTCGACGCGGTACGTGAGCAACTCGCCGTCCAGCGAGTAGCGGTCGACGCGG
GAGCGGTTGCGTGGAGACAGCTTGCGCATCGGGTTCTCGCAGGAGCTGGATCAGCTCCGAGCAGGACGCTTCCTCCTTGTACGCGTCCACGATCAAGTCA
CGGAGTGGACTGGTCACTGCAACTTCAACAGCAGCGACGGCTTCGGCAGTGCATACGGCGCACTCGTCGTCGTCCTCGTCGTCAACTGCGTGGCGACCTG
ACTGCACGTAGTCAGGCCGACGCGATAACGCGTCGGCAAGGATGTTGGTCTTACCCGGCTTGTAGTGCACGACGAAGTTGTACTCGGAGAACAGGGACAA
CCAGCGCGCCATGCGCTGGGACAAGTGGGGGCTCTTCGTCGTTGTCCTCAACGAGGCGTGATCGGTGTAGATCGCGAAGGTCTACTCGCCGAGGAGATAC
ACGCGGAATTTGATGATGGCGTAGCGCATGGTCAGCAGCTCCTTATCATGGACCGGATAATTCCGTTCCGCCGGCTTCAGCTGACGCGACTGGTAGCTGA
TGACCCGCTCGCGTCCTTCGTCATCGAACTGCATCAAGGCACATCCGATCGCGAAGTCGCTCGCGTCGCACACGACATGGAAGGGCTTCGAGTGGTCTGG
AAGTATGAGCACGGGCGCGATGGACAAGCTCGACTTCACCTCGTCGAAGGCAGCTTGGTGCTCGGGTCGCCACGTCCACGTGGCGTCTGCCTTGAGTAGT
TGAGATAGCGGACGGTTCGTCGAAGCGAAGTTCTTCGAGTAATGGTGAAGATACGTGGCGAGCCACTGCCACTGCCGGATCTGCTTCTGGTCCTGCGGCG
TCAGCCACGCGCAGATGGCCGCGATCTTCTCGGGGTCGGCGCGGACACCGTCCTTGCTGACGTAGCTCCCGAGCACAGGGATCTCGGGAGCGCAGAAGAT
GCACTTCTTCAAGTTGGCGTACAGCTTGTTCTTCTTCATCACCTCGAACACCTTGCGCAGGTGTTGTAGGTGGACCTCAACGTCCGTCATGCCGTCCTCG
GCACGACTGTGAATGAAGATGTCGTCGAAGTAGCTGGGCGCGAGGTCTCGGTACGGCCGAAGCAAGTTGGACACCATCTGGTTGAAGGTGGCGGGGGCGT
TCTTGAGCCCCTGCGGCATCACGAGCCATTCCCACAACATCCCGCTGGGCGTGCTGACCGCTGTCAGCGGCACATCGTCTTCGTGCATCAGGATCTGATA
CAAGCCACCCATCAGATCAATGGCACTGTACTTCGTGCTGCCAGACATGGCGTCCAGCACCATGTCCTTCCTCGGGATCGGCGTTTGCGCCGGTATGATG
GCCTCGTTGAGCTTGTTGAAGGCGTGGGCGATTCTCCAGCCGCCGGTTGCTTTCTTCACGCAGAACGTCGGTCTGGAGTGCGACGAGAGATTCTCGCGAA
CGTGGCCGGATTGCCGACGACTCTCGATGAAGGCGTCAATGGCTTCGACTTGGTCGCGAGGAAGCGGCCACTGCCGCGTCACGCAGTACTTCGCACCGAA
CACGAGGTCAATCTTGTGCCGAACCTGGAAGAACGGCTGGAACCTTGTCCGGGAAAATCTCCATGAACTCGCGCACGAGCGGAGCGACTGGGTTGCCGGC
CGCTTCGAGCGCCGGCAATGACTGAGCTGCGTAGCGGGCTTGATGGGCGTTCTTCGGCTCGGCTCCTTTTCGGCGCTTCCTGGCGTCGGAAGCTGGGTCC
GACGCACTGGTTGCGACGGCCGCAATTGACTCGGTGTCCTCGGCGACGATCATGCACACATGCTCGATCTCGCCCTTCTTCAGGTCACGGAGGAAGTGTT
TCCACGAGAGCACAGGCAGCCCAGTGACCTCGGCGGCGTCGCACGGTGGACGTGCGACTTCGACGTCGCGTACACGCGGAGCCGCCTCCGCGTCGTCCCC
CACCAGGACTGAGATCACTTCAGCCTCAGCCTCAACCGAGTCCGCCGAGGGCGTACGACGACGGCGCGGGTTGCGACGTCTGCGACGTCGAACCGTACGT
GGAGTGTTGTGCGAAGCTGCCGATGGGAGCCCATGCTCGATCACGGCCGCTGAACGGGGGCGCCGGGACACAACGTCGGCGCCTGGGCGCGGGTCATTGG
ACACGACCGCGTCGACTTCATCAGGGAGCTCCCGCTCGACCACACGCGGGAACCCATGCTCGACCGCGTGTGGGAGGCCACGCTCAACCACATCTTCTCG
CTCTTCAACGTTGGAGAGCCGCCACTCGTCCTGACGTGGCTCGACCACGTCATTGTATGCTTCCGAGAACCGCTGCTCATCGGGCATGCTCGACCACGTC
AGACACGTCCTGAGGCTCCTGCTCAGGACCGGCGCAGGTTGCGAGTTCGCACACCGCACACGAAGGGCCATCGCTCGCTTTGTGCGCAGCATGGGTCATG
GAGTCGGGGTCCATGACGGCAACATGCGGCCACTGGTTAGGCGTTCCGCACAGGAACGCCAATACTGCATTCACATCAATGTCTCGAGGGCGGACTGTGC
CAGTCAGCCAGTTGATCTCAGGCTGGTGGCGGGCGAGCCACGGGATGCCGAAGACACAGTCGAACGACCCGCTCAGCTCGATCACCAAGAACTCCTCGGA
ACTGCGGAACCCTTCGAACTCGTACGCGAAGGTCGCCGAGCGCCGCGGCTTCCCATCAGCGTACTTCACGATCATGTCGCCAGGCCCGTCGCGAATGTTC
ATGTCCGCCGGTAACACCGACAAGCTCTCGGCGCGAACGAAGTTGTTCGTCGCGCCCGAGTCCAGCAGCGCGCGAAGAGGGCGCGTCGCGCCGTCAACGT
GGAGGCTGAGCACAATCCGCCTCGTGTCACTGCCGGAGGTGGTGGCAAAGAGATGTGCACGAAGCCCGGGAGGGCTAGGAGGAGGTTCTGTCACCAGAGA
ACCATCGTTCCTTCCACGACAGGTAGGGCGCCCCGCACCTACTGGTTGTCGCCGTTTTTTGGAGCGGCGACGTCGTTCGCGACCGTGACGTTCGCCTGCA
TCGGCGCCGGAGCGCGGCAAACAGCCGCGCGATGTCCAGGTTTCCCACAGCGGTGGCAGCGCATCGGGCGGGGACTGCGCGTTGACGAGGCCGTTGGCGG
CCTTGCTGATGACGTCGGCACCCGACGTCCACCGAACCGTTGAATCGCATCCACCTCTATCGGCTCCGGCTCGGGCACCGGAGCCCGAGAGACATCGAAA
GCCTGCGATGCCGTCACACTGTAGTCTTCACGGAGCGCAACAGCGAAGGCTTCTTCGAGTGTCGGTGGAGTCTTCCGGGTCAGGTAGAAGCGCTGGTAGC
CAACGCTCATGCCGGAGATGAAGACGTGGACTTGGGTCGCCATGTCTACGGGATGCGTCGTGATGCACGACACAAGGTGTCGTGCGCGCTGGATGTACTC
GAGCATGGACATGCGCCCTTGCTTCAACGCCAAGAAGGCGGAGCGCTGAACCCTTTCAGCTTGGGGCGGCTCGAACGCGAGCCGCAAGTCCGCCTTCATT
GATGCCATGGTCGGGAAGCAGGAAGCGTCGGCCACGAGCGCCCACTCCTTCGCCTTCCCCGGCAGATTGGACAGGAGAAAACGCATGCGCGCGAGCTCGG
TAGACAGCTGCCGAGCTTCGATCGCGATGTCCACCTCGCAGAACCAGCGGTTCAGGTGAAGGCGGCCCTCGCCTTCACCGCTGTACGTGGAGACATCGAG
TTTCACGATGTCGGACTTGTTCTTGGTCTGTGTGGGAGTCGACACTCGCTGACGGAGGTCAGCGAGTTCACGCGCCATGAACTCCTGGGCGGCCAGGCGT
TGTTGCTCCTCGGTTCCCGCCGTCAGCAGAGTCTTGATCACAGCGTCACCAGACACCGCTGCGAGGCGGTGTAGCGCCTCCCACTCGATCGCCGACAGGT
GAGGAAAGCTGGCGTGCTCCAGTGAAGTGGCAGTCGTCCAGGACGCGTCAGGCATCGATGTGTCGTTCATGTTCATCACGATCTTGGGCGTTGGACGGAT
TAGCGAAATGCTACCAGCGGTAACGGGCTAACTGCAGCCCGTTACGTGCTTACAC