Description :
From Genome Similarity Track
Location :
Scaffold_505:1883- 3315
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_505-fgenesh-gene-0.3ATP-binding Cassette (ABC) Superfamily
Pytve_DAOMBR484maker-pve_contig_505-snap-gene-0.12Transmembrane protein

Sequence
1432 bases(100 bases per row)
AGAGAGCACCGGTCTGCCGGTCCAGGTGGAACTTGAGGTCGAGGTTGTGCAGGTGCTTGAACACGCGCACGGCCACCTTGCGGATCGTCTTCTGCGCGAC
CGTGGCGAACACCGCGTTGGACAACTCGGTCGAGGCGTTGGCGCCGAACCGCGCGATGCCGTAGCCCAAGACAAGCGCCAGCGGCACCGACACCTCGGGC
GTCTGGGCCAGCGCCGTCGAGGCCACGCTCAGCAAGTCCACGAGGTCCTTGAAGAGGAACGGCACCTGAATCGTGAGCGCCTTGGACGCCACGACGAGGC
CGGCCGACACGAGCACGCGCTGCTTGATCTCGCGCGCCTCGGCCGACTGCTCCTTCGGCCACAGGTGGCCCAGCAGGAACCCCAGGATCTCCTTGGACGT
GTCGACCGGTGGCGCGGCCGCCTCTTCCTTCTTCTCCTCCTCCTTCTTGTTGTCGCTAACTGCCGAAGTGGCGAAGCTCATCGCTCCGTTACCGAAGGCT
GAAGCAGAGATCCGCGACCGCAGGATTCGCGGCGCCTGCGAGCGGTCCAGCCGCCGCCACGACTGCTGCGCACTCACTGCGCGCACGCCGCGGAGCAGCA
CGCCCCTCGCCTGCAGCAGCGCCATGGCCGGAGCTCTTGGTGTCGTTTGTAGACGCAGCGCACGGGCAACGGCGGCGTAGATTGGCAAGTGGCTCGCCAA
TGTATGTGCGTCTGCCAGAAGAGCTGACGCGCCTGGTTATCCATGACCACTTCGCAAGTTGCGCAAAAGTTTCACGAAGAGTGCCGGTCGTTTACGTACA
GCGCCATATGCAGTTTTACGGCGCGTAAATGTTGCGCGAAGAATGCGGGTCGTTTACGTTTGACACTCTCGTCCGCAGATTGGCTGCTTTAACAACCAAC
CGCGAGAGCTGATTGGCTCGAAACACGAGCGTCCTATTCTGATACGCAAAACCAATTATGCTTAACCTCCATTGGTTTGACAAGGGATTGCATTATTGCT
TGTCATCATCGAAGTGCTCGCAGCTTATCCTTCATTGCCAGAGGGAAGACGCCCTCGCTCGCGTAGCGCACCGTATCGCCGGCGCAGTGCGCCAGCGTCC
ACTCGTCCTCGACGTCGCGCGACGCATTGCGGCAGAACGGCGTGTTGAACGCGAACAGGTCGATGGCGCCGGCTTCAGCCGACTCGCGGAGCCAGGTCGG
CAAGGAGCCAATGCGAGTCGATTGGACCGAGAGCTGAGTGAAGTCGCTCGACAGGCTAAGGTTGTCGGGCAATCGCTCGAGCGGGTTCGAGTCGAGATAG
GCATACATCCACGGGAGGTCGTCCGGCAGGTCGTCCGGCAGCATCGAAATGTTGTTGCCCACAAGTGAAATGTCGGTGAGTGCCAGCTCCGACAGCACCG
CCGGGAACTCCTGCAGGTTGCAGTGCTCAAGG