Description :
From Genome Similarity Track
Location :
Scaffold_17:188276- 189456
Transcript NameFunction/comments
Aphas_H257_07917Hypothetical protein

Sequence
1180 bases(100 bases per row)
CGTGATCGCCGACGCCAACTTGCCGGCGAAGAAGATCCGCAAAATCTTCTCAAAAAAACACGCCATGGCCCTTGATGACGTGGCAGGCACGATTGCGAGT
CTGTACCAAGCTAAGATGACCCAGGACATCCACGACGACTACAACGGCAAGCCTCGGTCGGGGTTCCTCGGTCTCGTGGAAGACTTGTTCATCTTGTACT
ACGGACTCAAGGAGTTGGCCATCGGCCAGCTCATCTGCATCGACACGGCGATCCACAAGTTTTGCGAGGTACATGCTCCATGGGAACACGTGTCGTCATA
ATCAGGATAGAACAACGCCCGGGTGCGACTCTTTGGCATCCTCATCGGGTCCAACGCCGCCGTGTGCGCCACACAGCCCATGGGACCGTCGCCAGAAGCC
ATCGACTTCTTTCTCTTTCTTGTTGGCGTGCTCTTTCACGGTACTACATAAATCGTGGAGGACCTACATTTTGGTTTGGAATGATGGTCTGGATACCATC
TTCAACAAATAGAGTGTTGGTCGTTTTGGGTGCAATCTTCAAGTGTAGACTTTGAATGTTGGTGGATCTAAACTTGGTTGCAGTGGGCCACTACACAACC
CAGTACGACCACGCTCTGGCCGTGGCAAAGCTGCTCAAGTCCCGGTTCGGAGATGGTATTCCGCACAGCCCCCATAGCACACGCATCAACGTCCAGGAAG
CGGTGCATGTGGTGCAGATCGCGTTTGCGTTCGACTCGACGACCGACAGCTCCGAGCACACCGAGTGCATCCAGCTCGTGCAAGCGTTGGCCCTCAACGA
CACGATCGACATCGACCAGTTCCTCGAGCAAGTGATGTTGCACTGGTTTGCCATGTACGACAGCCAAGTCGCGTTCATGCAAAAGCTGTTTCACAGCATG
GACCACGACAACAACGGCGTGCTCGAGTTCCACGAGTTTAGAGGTAACCAGAAAGTTTTCTTTGGGGGTTTAAGAATGATAGTCATACGAGGCTTTCTTT
AATGCCGAATGATGGTCCTACTACTAGGCATGGTGCACAAGCTGGACCCTGAGATGACCCAGCGTGACTCGCTGGTCATGTACAACAGAGTCGCGGGCGC
CGACAACGTGATCGACTGCAAGGAGTTCGTCGCGTGCATGATCAGTCACCAGCAGCACCTCATCTTGAAGACGTACTTTG