Description :
From Genome Similarity Track
Location :
Scaffold_137:188264- 191260
Sequence
2996 bases(100 bases per row)
GGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTCGTCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACGGCACTCTCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGATC
TCGGATGTGAGACCACTTTCGCTGCGGAAACAAGTGGAATTGTGTATGGATACCAAGCTGAGCGCTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCC
AAGATAAACAAAAGGAGTACTCCGACAAACATGGAAGAGGAAACTTAAGTGTATTTAAAGTGGGGGACTTAGTGTTACTAGACACGAGGAACCTACCTCT
TGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACTATCGACCTG
CCTAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTGACTCGCAGACCCACCTTGGCCCAG
CTCCTCAAAGCGAGGGCGGGCCACAGACGTCGACAAAGAAGTCAGAGCAGGCACCCAAGCCTCGGTCGGAACGGCAAGGCTGCGGTCAAGACCGTACGCC
GGAGGGGCTCCGTACGAACGGACCCCGGAGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCACAGGCG
GCTCCGGACGCGGCAGCAGAGCCACGATCCGTCGGATCATGCGGAAAGCTTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACTCGCAGATGCAGGCT
CGCGACCTCTCGCTCCAACAGGTCCAGGCAGCCCGCAAGACGAGCGAGCTCGCCCTGATTCTCGGCCTGGGCGGCAGCATCACCGCCAGTCCCAAGGCCA
AGTGCAATCTCCAGCACGAGGACACGTTGACGAAGGCGGTCAACCTCAGGGCCCTGTGTCGGACCCGCAGCCGGAGCACTCGGACGAGAGTGGCGCTCGG
GAGGCGTCGAGTACTCGTACTCTTACGAGGGCACCTCCGCCCCTGCTTGACCAGAATGGAGAAGTCCACTTCCACGTGAAGCGGATCCTCCAGGAGCAAC
GGCGTCGCGGTAAGCGACAGCTCCTTGTGAAGTGGAGGGGTTATGCCTACTCCGAGAACTCGTGGAAGCCGATTGAACGGCTCCTGATTGACTGCCCGAA
GGCTGTCGCAATTTGGGAATAGAAGCGATGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGTTGAATACACTCCGTACCCGC
GCTTATCGTGAGCGCTGGAAGCCGCACGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGACCAAGTGGGCAAAACCGAACACGAAGATCACGCTGGT
CCAGGATGCGGGACAGCAGCTGACCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTGAGAGACTCCACCCCAGCCCAGAACATGTCCTCACAAGA
ACTCCAGGTGGGGCAGTTCTCGGGCAGAGCCCAGGGGTAGCCCCAAAGAGGGTAGAGACCACCCCGGCTCTCGGGATTCTTGCGACAAGTCGTAAAGTCC
TTAAGGGGGATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAGCGAACAACTGTTCTTTCTGAACAAGGGCACGTTCGTAAATGC
CCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAATCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGA
GTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAACCCCCACGCACACGCAGGCAGCTTGGAAATCGGTCGAGGTCATTCGTGACCTCCCGGGGC
TCAGAGATTGCACCCTCCTCCTCATCGCTGGCAGCTTTGGGAGTGCCCTTAGCTTTGACGGCCGGACTCTCAGAGCGCACAGACGTCCTGGGACTGTGAT
CACCTTGATCACTAGAGAGCGACTGCACGCTATCGTCTTTGTGTTCACTGGGCACTGGGCTATGCCCCTCCGCAGAGCCCGCAGGAGCATCGTGCGTGCT
CTCGGACTCGGCTTCGTCCTCACTGCCAGAGTCGAACTCACGTTCTACGAACCGAGAATTCGGATGATTGTCTGGAGAGGCTGAGGGCGACGGGCTGCGG
CGCTTGCTTGTTCGCCTTGCCCACAGCCTTGTCGGCCGATGAACCGATCGCCTCGGAGGACGCCTGAGTAGCCTTCTGAAGTGCCGAGCCTTTGCCGTGA
GGCTTAGTGCTCCTGGCTTGCGCCTTTCCGGCAGCAGCCTTGAAGCGTGTCTTCGCACCGCTCCTTGCAGTGTCACGAGACATGGTTAACGGTCGAAGCG
GAGACCAAGACGAAGAGCGCACAGATTGCTGCTCGAGGCTCTAACTGTGAAGTGAGGCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTG
AGAATGAAAGTTTGTGACGAACACCTCTTCATTCTGATTGGTCGGTAAATGGAACCTAAGTGGGGGAGAATGTAACAGGGTACGTAGCCCTAAGTGTACC
CCTGGTTACATGAAGTATGATACGTCATACTTCGGGATATTTGGTACAAAGTACCAAGGTCGTCCAAAGCCAACCATTGGTTGATGACATTGCATTTATA
TAGGGTGACTTAAAGTTTGTATTAGACCCAAGCTTTATCTACCTTTAAATATACTCGGTTTACAATCTACCTTAAATTGGCCACTTCGCTCCCTTTCGGC
AAAAGGAGACCTGTGAGCTGCCGTTCACTGAGAGTTTGTAAACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACTCCGTCACACAT