Description :
From Genome Similarity Track
Location :
Scaffold_34:188240- 193882
Transcript NameFunction/comments
Physo_108807predicted protein
Physo_134812CG1017 CG1017-PA

Sequence
5642 bases(100 bases per row)
GGGGTTTCGGCGGCAGGAACCGCCTCTGGGGCAGATGGCTTCTCACTGCAGGTGAGTTCTGCACGCGGTCGATCCCTTGAGCGTGAGCGGCTGCGCCCCC
GACCACCTCTGCCTTTTGCTTTTCCGTTCCGGGATCGAGCTTTCCCACGTGTCGGATGATTGGTACGGTTTAATGCTTCGGCTTCTACCGGCGCAATTAC
CACTTGGCGACCACTGTCAACATCTTCGGTATAATCTGGTGGCGAAGACGAACCATTTGTGATGTGAACTTCTTCGCCCACGAGATCTTCAAACCAGCCC
CCTTCATCTCCCCTTTCGCTTCGCCGATCTTGGTCGTGAGACCTTACTTGCCGCGCACTTTTAACTCGGCCCCACAAATCGTTCATATAGAGTACTCGAG
ATGCTAGTTGTTGGAGATCCCCGGATACTGTACCCCGATAGCCTAAAATTCAACTCAGGTCATTAGCACTGCTTAATTTGATGGAGACCTGCAACGTGGA
CACGACAACGTACCAATCACCCAAATATCCTTATGAAGCACATTCCGAGCAAGGCTCAGCGAGCTGTAGAAATCTCCGTCCCCTACGTAAACGCATATAA
CCGGTAACTTCCAAACTGGCCACAAGAAACCCGTACAAATTGGAACCATACCGGCGAACAAAATAAATCGATCGCAAATCTGGACATTTGTAGCGTGAAC
AAGGTTATCAAATGACTTCATCAGAACGCCATTACCACATGCGTACATTTTCGTAGGCAAGTGACAAGATCTTGGTGGCGATTCTATCAGAAAGAAGGAC
GGCATATTAGCAAACGCTTTTCACGTGATATGACCTGAAGCACACATACCCGTTGTCCACTCCTTTCTGGACATTTTGAGTGAAGTGATTACCGCATCTC
TTGCAGTGGCAGCTATACTTCTTCATAGGGAACAAACTCACTTGGAACTGCGATGAATCAAACAAGTAGAGCTTTGTCAGCAACTACGCCACGAAGATTA
ATACCATAAAACTGCACAACCTGAGGTCCATCCGGTGGAGCGAACTTAAGCCTGTGGTACTCCGCCGTTAAGGACGCGTTGAGTCGCTGTGCGGAAGGGT
TCTGATCGAAGAACCAGCAATCTGACGGAGCAGGAAAACGTCAACAAGCATTTGCGGTGTTCCGGCGCCACAAAGCGCAAGGCGAGCCATACATGTACGC
AACGCCGAAGTAGCCCTAACAGGTGAATCTAATGGAAATCATCTTCCTACCTCCAAACGGGGCCTTGGCCAGTTCCTCCAGCGCTGCACGAAGCTTGATG
TAGTCGATCTTGCCTCCCTTCCGAGTGCCAATACGAGCAGCAGACGCTCAAAAATCAGTGCCAAACTAGGCATGACCCAAGAGCAACATATCTCCAGCAC
GCCAGCAGCAAACGCACCAAGGAGCGGGCGCCGATCATCGCGTAAGAACCGTCTGCAGTCATCCAACCAGTCGCATCGGGTAAGACTAAGAATCGTTGCA
AACGGCGCACTAACTGCTCAATTGTAGCTGCAGCCACGCTTACCGATAATGAGAGCCGTGCGCGTTGACCCAGCCGTCTCCACGGTCGATGCCGAAGACG
CCGTGGACGCTGTGGAGCTCATGGAAGACGCCATCGTCGCCGCCGCGCCGCCGTCGGCTCAACTCGCTTCTTGGTTCAATTGCGTAGCTTTTTCAGCCAA
TGGCGTTCGGTTTGTGTGCACCACATAGCACATACGTCGCCCCTCCTCCGTCCCTCCCCATCGACTTTATTTTTTCTATATTTTTGGATTTTTTCCCGCG
CAGTCAGTGGCCCAAACCCATCCAACAACCGAAATCTCGCCGCCGCCAACAGATCGCCGCGTATCAACCGCTCCCCCGAGCGCAGCTTAGCCCCAAGCTT
AGAACCAGACACCCAGCACGCAACCATGCCCGGCGAGGAGAACAAGGAGTTCGACGACGAGTTGGTCGACTACGAAGAGGAGGAGGAGACGACGACGGAC
GCCTCCAAGGCTGCTGCCGAGGGCAAGGACGCCAAGAAGTAAGCAAAAAGATCTCGACCCCGAAGGGGATTGCGTACCCGAGAGGGGGAGCAGCACCGAG
GAGAGAGAGCGAGCGACGCCGGGGGGAGAAGACGACGCTTTCTCGCTCGTTCGCCTGCGGTCGGAGGACCTCTTAAGCGCAGCCGCGCTGGCCGTCGTGA
TGACGCAATCGACGCTCGGTCGCTTATCCGCTCGCTCGGGATCTTCGAGGGAAGGAGGGGAAAAGGCCAGTTTGTTAACAACTTCTTCTGTATCTGTTCC
GTGCTGTCGCTGGATGGTGATCGACAATCGTGATCGCGGGGGAATCTTTCAACAGGGGCCACTACGTCGGCATCCACAGTTCGGGTTTCCGTGACTTCAT
CCTCAAGCCTGAGTGCCTGCGCGCCGTCGTGGACTGCGGTTTTGAGCACCCTTCGGAAGGTGAGCTTCAGTTGACTCTGCTCGTGGTGGGGTCATTGTAA
CGGCAACTCACGATCTTGTGTTGCATTTGCTGTTGATACATTGCAGTCCAGCACGAGTGCATTCCTCAGGCCGTGCTCGGCATGGACATCATTTGCCAGG
CCAAGTCGGGTATGGGAAAGACTGCTGTTTTCGTACTTGCTACGCTGCACCAGGTAGAGAGAGAGCTGCAACTTGGGACCGATTTTCTTGCTATTGAACG
GGAACTCATGAACTTTGTGCTGTACTCTTAGATCGAGCCCGTGGACGGTCAGATTAGCGTCGTGGTGATGTGCCACACCCGCGAGCTGGCGTTCCAGATC
GCTCACGAGTATGAGCGTTTCAGCAAGTACCTTGTGGACGTGAAGACCGGTGTGTTCTACGGAGGTACGTTAGATGCTATTTAATTGTGTTGGAATGATG
CATACCCTGACACGAATCTGTTTGCAGGCGTGCCTATTTCGCAGAACCGTGAGGCTCTGAAGAACAACCCGCCCCACATCCTTGTGGGCACTCCCGGCCG
TATCCTGGGTCTGCTTCGCGAAAAGACCCTGAAGCTGGACAAGGTGAAGCACTTCGTCATGGATGAGTGTGACAAGATGCTCGAAGCCATCGGTACGTCA
TGCACCAAGTATGACAGCGTCCGTTCCAGCGATTTATCAAAACCTGTTTTTTTCCTCGATAGACATGCGTCGTGACATCCAGGAGATCTTCAAGGCGACG
CCGCACGACAAGCAGGTGATGATGTTCTCGGCGACTCTGTCGAAGGAAATCCGCCCCGTGTGTCGCAAGTTCTGCCAGGACGTAAGTATTCATAGCGACA
TGATGGTAGTGCGCTTAGCCTCCGTTTCTGACGCAGTGTGTGGCGTACTTCTTGCTTCGACCAGCCGATGGAGATTTACGTCGACGATGAGACGAAGCTG
ACCCTTCACGGTCTGCAGCAGTACTACATCAAGCTGGAGGAGTCGGAGAAGAACCGCAAGCTGAACGACCTGCTGGATGCGCTGGAGTTCAACCAGGTGG
TGATCTTCGTCTCCAAGAAGAACCGTGGACGCGAGCTCAACCGCCTGCTGAACGAGTGCAACTTCCCCTCGATCTGCATTACGGCCGACCTCTCTCAGGA
GGAGCGTATTAAGCGGTACAAAAGCTTCAAGGACTTCCAGAAGCGTATCCTGGTGACGACGGACCTTTTCGGCCGTGGTATGGATATTGAGCGTGTCAAC
ATCGTGGTCAACTACGACTTCCCGAACGACAGCGACCAGTACCTTCACCGCGTGGGCCGTGCCGGTCGTTTCGGTACCAAGGGTCTGTCGATTAGCTTCA
TCTCGTCGGAGGAGGACACGGAGATGCTTGCTAAGGTGCAGTCTCGTTTCGAGGTCAACATCCCCGAGCTGCCCGACCAGATCGACATCTCCACGTACAT
GAGCACTTAGGCAAACTTTTCGGCTCTTGAGAAGAACAAGGAAGGGGGAGGAGGTTGCAAGAATGCAAACGCTATGTCCAAACCAACCAACCTCGCGCTT
TTCAACCCATACAAGCTCCATTTCGGAAGAAAGCTTTATTGCTGCTGCGTGGCTGAATGAATATACCCAAAGCGCTGCGGACGATGCTTTACGATTCGGC
TCGCGCTGTTTCTACTGGTGTCGTCCCAAGCTGCCGGTTCCAAGTGTTACTCTTTTCTCCGTCGCTTCGTCGACCCGTCGATTTCCTTCATGCCCCCACG
GTGGCTCTTGTACTTTTCGCGGATGCCGTCATTGCGAGCCCAAAGTGAATCGCGGCTGGAGGTATCTTGGTCTGCCAGATGCGTGTACTTCGTGCTATGA
ATTATAAGTTGGGAACAAAACAAAATCAACGGATGAGTGTTAGAAATGCTAGCAAGCGATCAAAGCAACCTCAGGAAATACCATACCGGCCCGCGCGTCC
AAAGTTCTTGACCTGCATCACTGCCGGAAGCATCTCCTTGTTGAACTTATCCTCCAGCGTAGCTCCGTCGGCATCTCGCTTACGCACGTCATCCTTCGAT
TGAATGCTATCGTCGTCGACGTAGAATGCGCCCTTGTGGTAGTATTTCTGCATGAATTTCAGCTTCTTCTTTTCCTTGGGCTCGTTCTTCTTCAGTTTAC
TGCAACACAAACCTTTAGTATCGCTTCTGATCATATCATCGGCATGCACATTCCGAAAACGTACGCGTCCTCAGCGGCCCGCTCTTCGGCAGTCATGTTA
CGTCTTCTCAGCGTCTCTTCTTCTTCCTGCCTGCGCTGTTCCTTACGATCACGATCACTACGGGAACAACATGCAACCAGAGTCAGAAGAGTGACAGGAT
GATTTCAGCCCACTTGGACATCTTACCGCTTGATACGCCGCATTTCACGCAGCTCCCAGTCGCGGTACTCTTGAGCCGGGTCCAGACCATCCGTGTCATC
AGCCATCTCTCCGTCAGTCGAGCCGTCCTTGTCAGCGCCGTCCTGCTCGCGACGAATCTCCTCTGCTACCAAACGGCGAGACTCCATTTTCCGCGCCTCC
ATCTTCTCCTGCTCGCGTTTCTGACGTCGTTCCTCCTCTGCCGCCATCTCCTCTTGTCGCTTCACGGTCCCGCGAGCCTTCTTGGGAACGAAGACGGGTT
TCATGATTTCCTCGCCAGGTTCCGAGTCATTTGTATCGGTCTCATACTCCGAGCTGCTGCTGCCGCTACTGCTACTGCTAGATCCGGCCCTTGCGTTACC
AGCCTTAGCTGCCGGGATTGCTCCGCTGCGCTTCACAATTTGAGGCGCAACAGGCTGCCGCACACTCTTTTTCTCGATAGCTGCCGGTTTTGCTTCCTCT
TCCTTTTCTGCCTCACGAGCCTTGGCCTTGCTGCGTAGCATGCGGCGTCGACGGTCGATATCCGAGTCGTCTTCCTCCTCCGAGCTCGAATCTTGCAGCG
CCTTGGCCACATCTTCATCGCTCGAGCCCTTTTCACCCTCAGAGGACGATGACAGAGCACGTTCTTTAGCAGCGGGTGCAGCGGCGCTGATGACTTGCGC
CTCAACGCGCTTCCTTCCCGTGGTAATCACTGGCGCAGGTTTGTGCTGCGCCTTAGCCTTCGGGAGCGCCCGCACCTGGCTGTTGGCGGTCACGAAGCCG
CGGTCCTCCTCGTAGCCATGTGCGAAGGCTGGGACTTGACCT