Description :
From Genome Similarity Track
Location :
Scaffold_31:188202- 200849
Transcript NameFunction/comments
Phyci_92273protein kinase, putative
Phyci_92274conserved hypothetical protein
Phyci_92275Hypothetical protein
Phyci_221515Poly(A) polymerase, putative
Phyci_453183Hypothetical protein

Sequence
12647 bases(100 bases per row)
GTTGGTGAAGGACTCGTCTTGGAAGTCGTTGTCCACCTTGTCGATGGCATTACCGGATAGATCACTACAGTACAATCGACAATCACGATCAGACAAAAGC
ATCCTTACACAAGTCGCAAGCGCGGAGGAATCCGACTTACATGACGGTGACGGAGTCTCCCGCGACGGCAGTCGTGGGGATCTCACTCAGTGAGCAGTTG
TTGAAATATCTGTTCCCGCCAACGAAACAAGTTAGAAACCACATCCACGAAGCATTTCCAGCTATGTCAACAGTACAACGCACATTCTTCTCACGCTGTT
GAGCGGCAGCGCGCTGTCCAGTCCGGACAAGCTGAGATTCCTGAACGTGACTTTATCCAGTGTCGCATCCGGCTGAATGTTCATGGACGACAGCTCGAGC
GAGCCGGAGAGCGGCTCCTCGCCTTGCTCGGCCTTCGTGAACGTCAGGTCTGTCACGTGGTCGTCCAGCTGCAGCAGTCCGACGCGCTCGAAGGGGCCGG
CGCCTGCAGTGTCATTGCTCTTGGCGGGCTGGAAGACCCACTCGGTGGCGGTTGAGGAGAAGGCGTCCAGACAGAGCGCCGACTGTCCCGACGACAGTGT
GACGCAGCTAGTGTCGTTGACGCAGTCGATGGCGTTGGCGGACGACTGGCCCACCACCACGCAGGCGCTGTTGCTGCTGCAGCCGCCGTTGCAGCTCGTG
GTCAGCGTGTTCAGGGTCCCGCTAGTCGCGCTGGAGCCCGTGGAATTGGCGGCCGACGCCGCGTCCAGCAGACCCAACGCCAGCGCCAGTGACAGTGTCA
GCGCGTGCATCCTCCTGCTGCGGAAATCCCTCGCGTGAAGGGGGCGTCAAGTGGACGGAGGGTAGGGAGGCTCGTACTACGCCGCGCCGCTGTCGCAGAT
GCGCTCCGAAGGGAGGAGAGATGGATACGCTACCGAGCCGAGCGCTGAAGTGGTGTACAGTATCAGACGCGAGGGACTGATTGATCCCCCGGTAGGAAGA
GCGGTAGAGTGGTGCGCTACTGCTGCAGCCGCCGCAGTGATTTGCCCGTCGCCGCCAGGGAGGGAACTCGACCGGGGGCGAATGGCAATGCACTGCAGAG
GGCGCCGAGGCCAGGCTTTTGCCGCCGACGAGTGCGCGCTCGTTCTGCGGCGAGAAAGCCGCATTGACAACGTGACGAGCCCGTGGTTGATACTTGATGT
GCGGCGTACACAGGTGCCACTCTTAGCTTCCCGCGTCACATGCGGCGCTGCGATTGGCCCACGAAGGGACGTCCTGCCCCGGCTCGTGCGATCGGTACAG
TGTACCGGGTGAAGATACTTTTTTTCAACCTGCACTTCACTTTGTCTTAAGCATCGCACGTGTAACGTGCTTCTCCATGTATTTACTGCATGCACTTTAG
CTATTGGCACGGGTCCGCCACTGCTTGTCGTGCGACAGCCTCACGAGTTACCCATTCTATGAAGGCGAAGGTGGTTCGAGGGCGAGCGCGACATAATATA
TTCTGAACATCTCTCCGTGATTCAGAGACGATTTATAGGGGGAAGACGCGCGCCCGGTCAAATGGAGGGCGATGCACGCCACCCAGGAATGAGTGGCTGT
CGCTTAAAGGCTCTCGGTGACGCTCGCGGCACTGGAGGCTGTCGCGTGCTCTGGCCTTGTCGCCAGCGATTCGCTGGAAGATTCATGGAGCCCCCTCGGG
GGTGACTCGCTGCTCCTTGCGCAGCCATGTCACCGCGGCGACGAACACCTCGAGCGCTTGGCGGCGCGCGCGCGGGAGGTACTTGGGGTCCAGGATCTGC
TTCATCAGGTACAGGCTGCTCACCGGGTTGGTGGCCAGGAACGTGTGGCGCGCTTGGTGCTTCAGAGCGCCCAGCAGCTCCACTGCGGCGAGCTGGTGGT
CGGTCGCTACGGTGGCGGCGGAGGTTGTGCTTGGACGGGGTAGCTCTACCAGATGACACACGAGGTCCAGCAACTCGACTGGAGAGCTGCAGCTGCAACT
GCTCCACGGCATCGTCGGTATGCTGGTGTCGACCACCACTTTCGGGGTGCTCTGCAGAAGCCGCGCCGAGGCGTGGGCGTCTTCCTTGGCGTAGTTGCGC
TTGACCTTGGACACGATTTTCAGATAAATAGGCTGCACGGTCAGCACTGCCACCTTCGCGTACACGATGTCGTGCAGCTCGGTCGAGTTTTCGTCCAGAC
CGCTGATCTGCATGAGCTCGACGAGCTTGTGCGTCATGACTTCTTGGTACAGAGTCGACACGCAGGCTCGCACGCTCTGAAGAGTGGGTCCTACTCCAGA
CACCCACACATTCTGTTTGAAGTCGAGCCAAAACTTGCGCAGGAACTGAGTCGCTGGCTGTCGGCCATCCACGAACAGCGCCTCAAGAGCCATTTGCATG
CGCTCTCGCATTTCAGGCACCGATACCAACAGAACACAGATATCTCGAAATGACACAAAAGACAATCCGGAGTCGTCACTGCTGCCGACGGATGCGGGTG
AAGCATCAAATCTACCACCGGAGAGGGTAGCTCCACCACTTACTGTTGCCGCTAGAACAAACGTAGGTGGGGCTGAAGATGTTGTAGTCGACTCATTCGC
TAGAATTTGCTGCGACCTTAACTGGTGGAATCGCGAGGTGGCAAAATCCATCTTGAGAGACTGAAAGAACTCCTGTAAGCGTGTTGTCATACTGGCAACA
GACTCGGTTGGAGCTAATTTCCCGCGACGTGGTGCTCGAGTTGGTTTTGGGGCAGGCTTCAGCAGCGCATTCTCAAGTACGTTGAGCACCACGTACTGCC
GTTCGAGTTTCTCCAAGTCCAGCATTTTCTTGACGGTGAAATAGCTTGCCGACCGCAATCGCTCAAGCATGACGCCGATAACCCCGATAAACGGGATAAT
TGAAGCAGCAAGCTCACCGGGAACGGATGGTCGCTCGCTTTCTGCGGTCTGTTTTCGTCGTAAGTTTTCAAATCCGCCAGTGTGGTCGCACAGACGTCGG
AGCTCACCAAGCCGTGTCTTGTACTTGGCACGAACCCTTTTCCAGGTAATAGGCATTCGAGTCGCCATCAGTGGTATGTCGCCGAGGCAGCCAACACAAG
CCATAACAAGGTGAAAGTTATTGAGAGGAGGTGCACTTGCAGCCATGGCAATGGAGATGATGTTCTCGATCACCTCCGCTCGTTCCTTAGGAGAGTCCTC
GACCAGCACAGACCACACGAAGTACGCTACCAACCGATTGAAATGATCCGTCAACTCTTTGGCAGCGATCTTGGGGTTGTGCAAGAACTCCCACGGGTAG
ACGTTCGAGAGCTGTGAATGGTGAAATATCGTGAGCTGCTGGGCCATTTCCGAGCATGTCATCTCCCACAACATACTTCGTAGAGGAACTGGTAGCGGGA
CATCTTCGCATTCAAAGTCGAGTTCTTCTGATGATTTTGAGTTGAACGTGCTCGCAAGCGGGATGGTTCCTTCTCGCGGTCCTCTACTGCTGATGCTGTC
TGGTTGCAGCGGACCGAACAGCACAGTCAAGTTCTCGCGAAGACGTTGGCTGCCTCCCTCGAATTTGCTGAAGGTAATAGTACGGTCATTATCGTCGCAT
GAAGTCTGTAGTAATCCCTTGCTTCTGGCTAGTTGCGAAATTCCGCTCAAGTTCGGGAATGAATGGTTGCGTCGTTTTTTTCTTTGCGGAGTTCGCGATG
TTGGAGTTTGTGGTGGGACGTTGGTCGGGGTAACAGGAGTTGCTGGGGCAGCATCATTTTCACTTTTTGCTGAAGAGTTGTTTGCAGATGCACTGCGCAC
TGGTTGAACTTGCGATTCCGAGTCATCACTAAACCGTCTGAGACGACAGTGTGAGAAGAATAAATCAATGAGTCCTTGGACAATTTCGGTGTTAACTTCT
TCGCGCTTCGAGTAGATGGGATGGAACAGCATATCCCGAACGAAAGCCGCAACATTGTGTTTCTGGGTACTCAGTGTGCGTGGAGTAAACGATCCGCGAC
GTGGGTTATCCCGTTGCTTCTCTCCGAGGGCCAGAAGAATGTCACCAACGGTAATACCAGCAGATGCAACCACTCCCAGGTGCAAAAGAACAACGCGCCC
ACCTTGCGATGAGCTTTCAATCAGCGTCAACAATGCTCGAAGTCGCTTCTGTCGCAACTCCTCCTCGCTGCGTTTTGCGCTCTGAACTCGTCGAAGTGAT
GGCGCGACTTTTGTGAACGTCGGGGCCGAAATGTTGCGAGGAATGAAAGTATCAATCTCAGATCCGCCCATCGAGAGATGGCACTGCATGACCGAATCAC
GCACACTCTGCAGTGCAAGCAGGGCGTCGTTATACCCTTCACCGTCATCTCCAATCGAATCCGTTTTGTCCGTCCCAAAGCTCGTCATAGAACTTCGCCG
CTTGCGTCCATCGTTGTCTTCTGTTTCTTCTCCAGGTATCAACTCTGTTCCGTCCTCTTCGCAGTCTGAACCTGCACGCTCCTGCGCGCCGACAATAGCG
CTGATCCATTCATCGCGTGTGGTGGTAGAGCGGAAGTCAAGCACGGTATCCCTTCCGTGCATGGACATCGTAAGCAGGGACTGCCCTCCGAGAAATGTGA
GCTTGAGGCTGGTATCATACAAATCGATCTAGTAGAAAAAAAAAACAGTCTAGGTAATGAGTGCCACACCAAGGCATAGCTGTTTTGACTCGATAGAGCT
GGTCACCAACCTTGGCTTTGATGGAGCCGTCTCGTCGGCGGCCGATAACCATCTCGCCCGGCTTGACAATGATGTAGCGGTCGCGCCACTGCAATGCACA
TCAACGACCGGTGAGACCACAAAACCTTCAAACTGCTGCCATGCTCATTACCATGAAGTGTCCGCGCACTGCGACGCTGCCCTCTTTAATCACCTCGTCC
GTCCTGTGGCAAGCGCGGCTCGTTAGTCACCAAACTCCATTGAGACCGTCAGTAAGTGAGCGGCACACGCACTTGGACGATGAAGCCGCGGGATCCATAG
CGCCTTGCAAAGCCGATCGGCGCCGCTAAGATAAATATGTAATCGAGTGTCGTCGGCAGCGCGGCGGCGATAATGCAGTGGCAGTATAAGCTACGCCAAG
CCTGCTGGTCCTCTTGCTCCGCGGCGATCAGCCCGTTGACCACTGGTAACCTCTTCCACTGTGCTGACAGACGTTGAGCTATTTGGACTGCCGAAGTTCG
ACACCGAACCGCGTATTCTTAGGAAGGCCAGCTGGGCGCACTCACCCACATCTGCTTTTCTAGCAGACCCGCGCCCATGCGTACAGTGGACGCCGTACAC
CGCTCGAGTTGACGACACCCCGTGGAAATGGGGACAGCCACATCTTTTCGTGCGCGTCTTGCAAGCGTCATGTTTGCGGTCACCGCTCGTGGTCACCTCG
AAAGACGAGTCGCGCGTCAGTGGCGAGCGAGGATAGGTGGTGATGCCCCAAGGCTGCAGCGATCTGCTAGCATTGCATACGTTCACGGGTGGACGTTGTA
GTGGTCGTAAATATGGCGCGGTTTTCCGGCTCTTGGCCCAACTGGTCCAACTCTTGTGACAGCAATGTCACGACTGAAAGGACTGAAGGTGCTCCACCGC
AACGTACATGTGCATATCAGAAACCTGCACACGAAACGAAATTACGAAATAGGGACGACTGCTGCTACTAGCGCTGCTCACTGTGTACACTGCCTCGCTC
TAGACCGAGTCGGAATCCACGTCTGCACTCGCGTCCTCCTCTCGCTTCCGCTTGAGCGGGCTGCTGGCTGCCTCCGTCGCTTCCGGCTTTGACTCTTGTT
CCGccttctccttttccttctccttctccGCGTCCGAGTCGTAGTCATCCGAGGCGACTTGCGGTGCCTCAGGCTTCAGAATCGTGAACCGCAGGTCGCA
GTCCGCGGTGGCCGAGTGATTTTTGACATAGTACACATTGCCAGAAGGCACGTAGAACTCATCGCCCGGGCTGAGCAAAAAGTGCATCGTGTGCTTGCTC
TCAAAGAAATCGTCGTCCGTCTCGGGCGCCAGCGCCAACTCCAGCGACTTCGGTTGACATCCCGTCACATAGAACAACTGCACTGCTTGGCCCACGCCCT
CGGGCTCCTTCCACGCACCGGGTGGCAAGACCACACGTCCCGATATCCACCGAGCAAACGGAGACGGGCTAAATAGATTGAAACTCTGCCCTGCGTACGC
GTGCACCACAGCACCCCCTCTTTCTTCGGTAGGAAGCTTGCGCAGGCGAATTTCGCTAAAACGGCAAATAACGTTCAGATCGTTCATACAGCCGGCTTGG
CTGTCAAACAGCGTCGCCCACTCGCTATCGATGATGCGCTTCTGCAGGTCCTTAGGCAGTTCCTTCCGAGCTAGTGCCCTGCTGTTGTTTGTCCGTTTCG
ACGGGGGCTTGGCTCTGGTTCGCTTCGACGTCGGAGAATCCTGACCGAGACGCTCCACGCCAACAACCGTTGGCATCACAGTGCCCACACCAACGAAAGT
GCGTTCGTACACCATGTGCTCACTCTTGAACCAGGCGAGAGGTTTAAAGCGCTTCCGCTTGGACCGCCGTAAGCCACTGCCATCCCAAGCATCACCATTC
TCGTCGTCGTCCAAAATCTTAGACGCGTCCGGCAATCGGTCGCGAACTGGGCCAGTTGGTGCATCTGGTTCATTGTAGAAGCTGTCATCTCCAGTCTCGC
CGCCAGAGTCATTCTGGGCTTCGAACGATTCGTCGTTATCGTCGTCCGTCTGCACGGATTGCGTCGATGTGTCTGTCCCGGGAGTTGTACGGTAGCCATA
TTTGCCTGTCGGTCGGATCCGAGGTTTCTTACGCTCGTTGATTGACTGTTTTCCTGCAGTTGTCTTTTTCGCCTTCTTTCCCTTGGCCTGCTTCTTCTTG
GGTTTCCCATCGCTCGCATCGCTTGCGTACTCATTTTTCTTGAAAAGTTCCTTGCTGATGTTGGGCGAGAGTGAGTTCTTGTCCGAGAACGAAGGAATAG
ACTGTAAGCTGCGGTCGCTCGCTATAGTTCCGATCAGGCAATTCGATCACATCAAAGTGTCAGACAAAACCCCACGCAGTTTTTGCAGACAGTAGCACGT
ACCATTCGAGAGCGGGGTCACCGGTCCTTCGTTCAAAGAGAATGGACTCGTCGTGTCTTTATCGAAGCCACGCGCACCACCAAACGATTCTCTCCGGCGA
GCCTTTGCCTTTGCCTTTGTCTTTTCCTTATCTCCCCCATCGTTTTCCTTCTCAATCGACTTCTTGCTACGTCGGTCACGGACCGTGACGTTCACATTTG
CGTCCAAATCCACGTTCATATCCACAGAGCCATGTGGCGAGCCTCCAAAGTCAAACGACACGTCGCTCCTCACCGGGGACGCTGGGGGAGGCGGCCCCGC
GTCGTCCTTCTTCTCCTCCTGCTCCACCCTGGCACTGTCGATTCTCTGCGTTTGCGGCGGGATGGAGCCCCGCTCGATGTCCATACTCTCGCGATCACTC
GATCGGGGGCTGTCGATCTCCGGCAGCTCCACCTCGTGCTCGCTGGGCTCCGACACGTCCCCCGACGTGTCCGCGGACTCCTTGTCCGAGCCCGTCAGAG
CTGTCAAACAAGTCACAGCATAAAGTCAGCCACAGATCCTCCAACATCATGTGCACTGCAGACACACACAGTCGTCGTCGTCCACCGAGTCGTCCTGCAT
CGAGTCCCCGTCCACCCAGAAGTCGTCGATGTCCTCGAAGCCTTCCGCGTCCTTGCGCACGTCGCCGCGCACCACCACCCCCGACCGCCTTGCAGCAGCA
aataataataataataataataataatGTCAATACATAAATTGCAAGTGGGTATTGCACGGTCGCTTTTTCTCTTTTTGCTCGTACGCTCCGACGCTGTG
CGCGTTCTTCTGCGTGGCCATGTACTGCTTCAGCTTGGCCGCGTCCACGGGCGCGCGGTCGTTGGCCGCCCTGCGCACACAAACCACGCAGCACTCCGTC
AGTGTTTCCCGCCTCTCAACCGGTCGCAGCGCGGGGAGACGCACTTGGTGCGGGGCATGAGCGCCTCGATGTCGTCGTCCATCTTGCGCCTGTGGGGAAT
TTTGTGCCCCAGAGCTTTTCAAATTCAAAGCAATCACACCTGGGATTGGTGGAAATACCAACCAGCCTTTTCCGCCAATGGAATCTAGAAGCGTTATCGG
CCAATCACCAGCGCAGAGACAGCGCCCGCCTCGACTGACACAAGCAGATTGGCGCTGTCGCAAGCAGGAAACCAACGAGCAGCTACGTTAAGGCCGCAGA
GCAGGACAGGCACGCCACGCACGAACgcacagcaagccagcacagcacagcacagcCGCCTAGCGCACTACCGCATTCGCCTCGCCTCGCCTCTCGCTTC
TCGCTGCAGCCAATGCAGAGCTCGACGTTCACCGTGGCGCCGCACGTGCTGGAGCAGGCGTACAAGGCCATCCGCACGACGCCGCCCGAGCCCAAGGACC
TGGAGCAGTCGGCCAAGCTGCAGGCCTTCATGGACGAGCACTTCCCCACCGAGTCGGACGCCAACATCACGCGCCGCTCGCTGATCCTGGCCGAGCTGCG
CTCCATCTTCCGCCAGTGGGTCAAGCAGGTGTGCATGGACAAGGGCGTGCCCGAGGAGATGGCGGCCGACGCAGGCGGCCAGATCCTCGTGTCCGGCTCG
TACCGCCTCGGCGTGAACGAGCCGGGCGCCGATATCGACACCATCTGCGTGGCCCCGCGCCACGTGACGCGCGAGGACTTTTTCTCGTCGCTCAAGGACA
TCTTCCTCAAGCACCCCAAGGTGTCCAACCTCGTGGCCATCGAGGGCGCCATCGTCCCCATCCTCACGTTCGACTACGAGGAGATCAACATCGATCTGCA
GATCGCCATCCTGCCGCGCAACTCCATCCCGGAGAACCTCAACATCCTGGACGACCACGTGCTCGTCGGCGTGGACCCGGCCACCGAGAAGAGTCTCAAC
GGCCCGCGCGTGACGGAGCTCATGATCAAGCTCACCCCGAATCGGGAGAGCTTCATCAGCGTGCTGAGGATCGTGAGACGCTGGGCCAAGCGCCGAGGAC
TCTACTCGAACAAGATGGGATACCTCGGCGGTGTCAACTGGTGCATCTTGGTGTGCTTCATTAATCAGCTGTACCCTACCGCGTCGCCGTCGACGCTGCT
GCTGCGGTTCTTCATGGTCCTGAACAACTGGAAGTGGCCGCTGGCCATCCAGCTCTGCAAAACCCACGACGCGAACCTAGGACTCGAGGTCTGGAACGCC
AACGCGGGCCACAACCGGTGAGTTGTGCGGTCTTTTCCATATTTTTATTTACTGCAGGTTTTCACCAACGGATTATGTTGCTGCTTCAGGTACCAAGTGA
TGCCGATCCTGACGCCGGCGTACCCGTCGATGAATTCCTCGTTTAACGTCTCGACCCACAGTTTGACGGTGATGAAGGAGGAATTTAAGCGCGGCTTGAC
GATTGTGCAAGACGTCCTGAGCAAGGGCGGTTCGGAATGGGGACCTCTATTCGAGCCTTCGGACTTTTTCGCCGTCCACCAACACTACCTCGCAGTCGAG
GTGTATACGGAGAAACAGGAGGAGGAGCAAGCCTGGTGCGGCTTTTGCGAGTCGCGTATGCGTAAACTGGTGGAGTCTCTGGCGTATAACCCGGCGCTCT
GCCGCCTGCGAGCATTTACAAAAAAGTTCCCGCTAAGTTTTGTGGCAGGTGAGCAGCCTAACGGTGAAGTTCCGGCGCAGCCCAGTAAATTTGGTGTGTG
CTTTTACGTGGCGTTCGACATTGACCGCCGTCAGCTACGTAGTCGTGAAGTAAGCATCGACAACTCAGTGGAGTACTTTAAGAACAATGATCTGTATCGC
TGGAACAAGCGCACAGCGACCATGGACGTGCGAGTCACTCCGGTTGTATGGAAGTCGTTGCCGGAAAGTGTTTTTGAAGATATGGGTGGCCGTGCTGTCG
CCCGCGTTGCACGTCGTGAGTTCATGAAGAAGAAGAAAGAAGATGAAAAGAAGGCTGAGGAGGCTGCAGCGCCAAGTCCCACTCCTTCGGGCGATGAGGG
TATGCACTCGCAAGAGGATGGCGATGATTTGAGCTGCAGTCAAAAGGCTGCATCGCTGGCAACCGAAATGGCCAACGGTAAGGGCAGCATCTCACAGCCA
GGGAGCCCTGATCCCGCAGCTGACAGTGGAGAGGTGGCGAACGGCACCGAATCGCTCAACAACACTCCGGTCAAGCCGACGAAGGAGGTTTCGTCGGCAT
CACCGGAAATGACAGGTAAGCGTGATCGCGATGGAAAGGCTCTGGTGGGAGGTGGCAGTCCAGATGGGAAACCATTGGATGCTGCTCCCAACTCGGCCAG
TACGTCGACAAATGGTGCGGTGGCGCGAGGGTTGACTTCACCTCCCGTGAAGGTGGTGAAGAAGCCCTTGGAGATGGCAGCGGCTCCCCCGGCCGTGTCG
TCGCCGCGCAAGAGACGTAAAATGAAAATCACTTTTGCCAAACTGAATTGAGGAGGTTATGCCCAGGGCAATGGTGGCGTGGGTGATGACAAAAAAGAAG
AAAAAAAAGAGGAACACCATGGCATGCCATGGAGAAAAAAAAAAGAAAATGGTTCCCACCAAAAAAGAGGTAGCAATAGCAGCAGCAGCAGCGAGGACTC
CTCGACAACCAGGACGAAGCTTGCAGGGTGACAAGGATGGTGAGCGCAAGCAGATTTTCTGTTTGAGAAGCGAGTGGGCCTCTTGTACGTATGTTGCTTT
CAGGCTCGCGAACGACAGCGACGAAGACGTGACCGGATGAAGACACTGCAGGCGGTGGCCGACCCCGTGCCTGACAAAGATTGATCTCTGATGCTGGTGC
GGGGTGAATAGATAGGAAAACACACTTGCAGGCGGGTCAGGAGGATGGCTACCCGAAGCATCCAGACCAGGTCTGCAAGACAATAAAAACTAAATAACAC
TAGCAAAATCATAAAACATTGTTTCTGCATTTGCGTTACCGTCGGCTCCGCCCACTGCGAAGTTAGTTGGAAAACAGGAAGAACGACACCAACTTCAGCC
AAAAGACCTTTTCCACCTCCGTCAGATCGTCTTGCTCCAAAAATGCAGACAACTCGAATCGTGGCGGCGACGACGATGTAGGCACTTGAGGTTGCGAACA
AGCAGCCAACACTCGCTGGAACTTGGCCTTCCAATTTTTGTCAGTAGATGGTGGGTGCTCTCGATCTGGTAGCGAAGAAGCCGAGGGACCAACAAAATAT
CTCACCAGCACACTCACAAAAAATGCATCCACCACTGACTCCGCTTTCACCAGTGAGGACGTGGCTTCCGCCAGCAACTGAACTCGAGCAGAAGCCAGCG
ATGTAATATCCAACGAGGTTCGATGCCACAGAGCACTCAGAGCTTCCTCCGTTTGGTTTGACAGCCACACCCCAAAATCTCGCAATGAAGGTTTCTTCTC
CATAGTCCCGTTGCCTTCCGAATCGTCAAGAAGCAAGAGACAGTAGTCACTGAACAATGTTAAATCCACGACTTCCGTGTTGCACATCAACTGTGGCACT
TGTTGCAGACGGAATAGCGCATGCAAAGCATTAAGGTAAGGCGGCACCAGCAACTCTGATTCCTCTTTGACGAGCTCCAGGGCCTGTGGGTTCAATTGAG
ACGCCCACCAACTACTTCCCCAATCAGTTACGACCAGCTGCTCCGTTGGGTTATTCTCCTCGCCGTCGCAGTCTTCGTCATCTTCACCAATGCCACCCCT
AGTGAAATAAATCCGAAACAGCCTTCGCAACCGATTGTCAGAGATATTACCTCCACCATGGCTCCCCACGTGCACGTCGTGAAGCTGTTGCAATTCTCCA
GTGAGACGACCGGGGTCTTTCCGCTGCCGGCGCTTCAGAAAAACAACGTTCTTGTTTTGCAACAGTTCCAGCCGCAGCGTGTTAGCCGTTTTCACCTTGC
TCTTCTCCAACGATGCTAGCTCGTCGGATGATGATGACGCAAGGATTTCAATCGGGTAAAATTCGGGATCGGAGATGACGAGCCGTTTGATAGTCGACAT
CTCTGGAAGGAGACATGGACTTCGCAACGTTCGGTACGAAGGTTGAGGGCCATCATCACCATTCAAATCTTGATTCGCGCCTGGATTGAGGTCCACTAGG
ACGTTGACGGCTGAAGTCATTTTAGTGTTCACGTCCACGGTCTCCAGCAATCGCGAAGTATCTACAGCCAGTACGTAAAGGTGACGAAATGCCTGCAGAT
GATACTTGTTGTCCGCCGTGTTCATAGGTGGCATCGGGTAGAGCGAGATTACAAGTGCCGCAATAGCCTCCTTAGAACGCGAAACTGTTGCACGTCCACC
GCCCAGGAAAAGCACCCCGATCGCCATGCTAAGCGCCATGTGGTTACCATAGCTCATTGCCGCATCCACGTGCTGTCGTAATGCTAACGAGCGTAGGAGT
GTCAGAGTTTCCACGTTTCCCGTTCCAGCATCAATTAAAGCTAGGGCCTGTGCACATACAGCCAAACACCGTTCGACGGTAGCTCGCTCGGTCGCAGCAG
CAACAGTATTGCTACTACCGCGCAATACCATTGATGATGACACCTTT