Description :
From Genome Similarity Track
Location :
Scaffold_54:188167- 194518
Transcript NameFunction/comments
Physo_109032reverse transcriptase
Physo_137453reverse transcriptase

Sequence
6351 bases(100 bases per row)
TTCGGGCGCTGCTGTTAACAGCAGCGCTCGCATTACGTTCCAGTATGTAGCGCATGGTGGGCTTCGTACGCCCTCACCATGTCCGGGACGTCTTCGAGCA
AGACGTTCCGCGGCTCCCATGTATCTTGGTTGGGAGGGAATCCTCTCCAACGAATACGAAAACGAACTGGTTACCTGTTCGTTCTCGTGATACTGTGACC
AACAATCCGCTCAACAACCCATCGAGTTGAGCCGTGTGCATCACGAATTGGCGGCGGTGGTGGTGGAAACACGCCCCGTGTGTGGTCAACTTGGTGTTGA
CCCTGATCTCGTGTCTCCCCACGACCGAGTTCCGGTCGTGGAGTAGTTCTAGAGCGCTGGGTTCGGCGTTCTGAAGTATCATCAGGTTGCGGCGGCCTCC
CAGACCGCCTCGATCGTTCCGGCCGAGCTGGACCATTAGCTCGACCCGCTGCTCCAGCGCGACTTCGCGCTGGAGAGAATGACGGCTTCCGCCGAGTCTT
CTGTTTCGGTTCAACCGAGCTATGTAGGTATGGCTTCAGCCGTCCGACGTAGAATGTCGGATGGAGGCGCATACTAGGCGGTATGTCCAGTGTGTAGGCG
TTGCCGTGCCGTGCCAACATAGTGAACGGACCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACTGCATGTTAAGGCAGGTTTTGAGTAG
CTAACAAACCAATGAGCCCTTCTTGAATTCATTTGTGTTGCCCCTGCCAACATTATCTGCGTTCAGTTTCTGTCGGTCGACAGAAGCTGCGATAGCGTCC
TGGACAAACCGAATGACGGCTTGTCTGCAGTGAATTGCGTCCGAGCTGAACTCGTTCAGCTCGCTTCCAGCAGTAGGCCCTGCCTCTGGGTTGGTCTTCG
TGGTGTCTGCGCCCTGCACAGACACGCTCTTCTTCTTGTTCTTGTTGGTGTCTGTGCCCCGCACAGACACGTTCTTCGTGCGCTTGTCGGCGTCTGTGTC
CTGCACAGACGCGCGGTTCTTGCCTTTACTTCGTGTCGTTGCGGCTGACACTGTGCAAGTGTCAGCGGCATTCTGCGGCTGCTGCGTTGTAGTCGTGGAC
CCTCCCCCACTTAATCCTCCCCCACTTTGAACACCATGTCAACGAACAGACGCGCCGTCTGCTTCGCAGTCACTTCAGCGGGTACCGCAGCAAGATGTGA
AGCGGTCAACAAAGACCACAATGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCCGACGGAGT
CGGCAGTGACTGCAAGGGAGCCTGCGCAAAGGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTATACTGGTGG
GCCCAGTAGAAGTCCTGCGTGAGAAGAAGTTATGTCTTCTCACGGCCCAGATGCCCCGCAGTCGGTGCATCGTGATACGTATACATGATCCTGAGTCGCA
GGTCATGGTCATTGGGCACAACAACGCGGTCCGCGTTGTCGTCGACTGCACTGTAGAGTAATAACCCGTCGTTCACCCGATAACGGTGTGCACGAGCACG
AAGATACTTCGGCAGCTTCTGACGAGCTTTGTCAGAAGGCGCTGAGCCATAGGCCAGCAAGAACTTCGCGTCCGCGTCGTGCGCGTACGCGACGTTCACG
TCGTTCACGTCGTCCAATAGTGACGACGTTGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCA
AGAGCGCGTCGGCCACTACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGCTATCCGTTGCGAGAT
GTGCGGCGACTTCACAGCCGTCCGCAGCTACGCGTGGTCCGTATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTACGTAC
TTCATGGCAAGGAGTTCCTTGTCATGCACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGGCCACACGATCACGACCCTCGTGAT
CGTGCTGCATCGATGCACATCCGACTGCGAAGTCGGATGCGTCGCACACGACGTGGAACGGGCGATCTTGGTCGGCCACCGCCAAGGTCGGCGCCTCAGT
CAAGTTCTGCTTGACTGCATTGAAGGCCTGCTGACGCTCAGCAGTCCAAATCCACTCGGCGTCCTTCGTCAGGAGCTGTGACAGCGGGCGTATCATGCCC
GCGTAGTCCTTCACGTACTTGCACAAGTACGTGGTCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCATTCATTGATCACTCTGA
CCTTCTCAGGGTCAGGGCGGACACCGTGCTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTTGCCTCGAAGATGCACTTCTTCAGGTTCGCATAGAG
CTTGTGCTTGCGCTCATGCGCAAGCAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATCCCGTCCGCAGCCCGGATGTGGACGAGCACATCG
TCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCATCAGACCCTGTGGCATCACTA
GCCACTCCCAGAGCATGTCGCTCGGCGTGCTCACAGCCGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCATCGCGCAGGTCAAGAGC
ACTGTAAATAGTGATCCTGGCCATCGAATCGATGATGACATCTTTTCGCGGTAACGGTGTTTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCA
TGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGCGATTTTCGATCCCGCACTTGTCCAGCTTTGCGACGACTCT
CAAAGAAGCCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTCCCCGGCACGAGATCAATCTCGTGCTGGAT
GCCCTTATCCTGCGGAAGCTCCGCAGGAATCTCTTCCGGAAGTACGTCCGCGTACTCCAGTAAGATCTCGTAGTAGGGACTCGTCTTCAACGAGTCCCAG
CTCTGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGCTCTCCATGAAGAACTGCCTCAGTTCGTCATTCTCGC
TCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCGTGACTGGAAGCGAAGT
CAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACGTTCAGCGTCTCGACGTCAGGC
TTCTCAGCCTCCGTTTGCCCGGCAGACATTTCTTGTAGCGTCTCGGCCTCGGGCTGAGACTTGCGCAGCGACCTTCGCATGCGCCGTCTTCTTGTTTTGG
GGAGCCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTCAGTACCGCCGGCGGGTCCATCCCGCGGGCGAGCGAC
TTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCATGCAAGTTTTGCTGGTGCGGGACGTTTGCAACCGCCCGCACCG
CTTGCAGCGTCGACTCCCGGAGTCGACATGCCATCCTTACCTCGACGCCTGTTATTGGCGGAGCCCTCCATTACGGAGGGTGCGTCGGCTCCTCGAGCCG
ACGAATCAAATTCGTCCAAGCTATCGACCCCCGGAGTCGATGCGACTTCAATACCTCGACGCCAACCATTGGCGGAGACCCCCATTACGGAGGGTGCGTC
GGCTCCCGGAGCCGACGAATCAAATTCACCCAAGCCATCGACTCCCGGAGTCGACGGCATTACGTCACCTTGGCTCTTATTATTGGCCAGACATGATCCA
ATCAGATTCGCGTCAGCCTCCACGGCTGAAGCGTGTGACTCGCCTGCGTCATCCGTGCCTCTTGAGGCCGGAGACTCTTCCTGATTCGCTGAAAAGCGGG
TGTCGACCTCCGAGGTCAACACATTTCCTTCATTAGCTGTCGGTGGCAACGTCGACGCTAGCTGTTTTTGTGCGTGTGCTCGTGCGCGCCCAGGGCGCTC
CGGGACAGCGGCATTAGGTGCTGTCTCGAGTGGGGAGTCGCGCGCATCTGTTCGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGCTGTCG
CGACCGAAGCACACGAGAGTGCGCTTCTCCCAATCGATGACCGGATCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAACTTATCGTCCAGAT
CCAGGACGATAAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGTGTACCATGCGCTTCTCGGTTATAACGATGGCACCCGTTGCCAATCG
AACTTCCAACATATTTCGAGGTATAATTACCTCCTCGAAATCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTGTTCGACGCGCCCGAATCAACCAAA
GCACGAAGAGAGTTGCTCTCTCTCTTCGAAGACACGGTCAAGATGACAAGGTTCGGTTTGTCACCATGCATTTTGCAGTGAGAAGGGCCCTCACTGGGGG
ATGCAGTCCTCAGTGTCGCATGTCCGAGTTGGACACGCGTGGCGGCTTCACCAGTAGGGCACCCCGCGCCTACTGGGTCCCAGCGTTTTTTGTTTGTCCG
CGACGATGCCCGGCATCGCCGCGTCGACCACCATCTCGGTGCACGGGTTCCGTGCACTCTCGGGCATAGTGACCGATCCTTCCGCAACGGAAGCATCGTA
TAGTACTTCCTTGTTGCTGTTGATAATCAACAGCCGTTGCATTCGAGAGGTCCATTGGTTCCGGACCTCCCGCTATCGCAACCGGAGGCGGTCGCAGCCT
CGGCGCATTCGCATGAAGCTTAGCCTGTCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTAATTGCAGCTTCGAGAGTACTCGGGTACTCACGGAAGAGA
TAGGTCTTCACAGGCCCATATCTAAGTCCTTTCATGAACGTGACGACCTTGGTCGCCTCGTCTATCTGGTTGGTCACACAGTTCGAGACCAAATACCGTG
CTCTCTGCGCGTAAGCATCAACATCATGCTTACCCTGCTGTAGGTCGAGGAACTCTGCCCTCGACCGGAACTCGTTTTGCGGGGGCTCAAATGCATGTCT
GAGCTCCTCCTTGAAACCCTCGTACGTGCTGAAGCACGTAGGATCAGAGAGTCGGCGTCCATACGCCCAACTTCTCGCTCGTCCGCCAAGACATGACATG
GCGAACGCAACCTTGGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGCCACCGGAGGAGAGGCTTGCCCTCTCTTCCGA
CATAGTTGCTCACGTTTAGCTTCAACGATTGCTCGCGCGGTGTCGTCCCCGACGCCACCGTGATAGAGGAAGCAGCATCACGCTGCTCCTTCATGATGAA
TCCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGTGTGCGCAGCATTGCAGCTACAGTCGCTTTTCCAATGACTGTTGACAGTCTTTGGAGTGCCTCC
CACTCTGGGTCCGACAGGTGGAGGTAGTCAGCGCGTGCAACATGAGTTGCAGGCGAAGTGAAGCTTTCCATGGGCACTTCCGCGCTCATGAAAAGGTTCT
CGGCTCCTCGTTCGTACAGCTCCGTACGAACGTTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAGTGGGCCTACCTTGGCTCACT
ACTACGACTTACACGTATGCCCACGTGTATGAGGAAGCGTAGGTTTCTTTTACTTGAGTTAAGTATACTCGAGATCCACGAGTACACTTTAAACAAGATA
AAGACTCCAAGTAGCGCGTTTTGGTAAAAGATGAGAACTGTTATTTTTGTTTTATGTTTCTGACTTCCCCTAAATGTAATATTCTAAAATAGGAATCTGC
CAACGACTGGTTGGCAGGATTCTGCTAACATGCAAGTCACTCATTGGCTAAAAGATGCTGCTTTCAGCCAATAGGAATCCTAAATGTGTATGGACCACCC
GTCGTGGTGGTCGTAAATGTATGTAGCCACTGGTGTACCTTACACCAAGGT