Description :
From Genome Similarity Track
Location :
contig_44:1881- 4635
Sequence
2754 bases(100 bases per row)
ACCGGAAAGTATACGCTGTTCTTGGACTTAGAAGATTCTGCTCTGTTTTGTTATCTCTGTGTGGCGTTGGGTTTTGGTGCCGAACTGTCACGGTCCGGCT
GACGTTGCACCTTTCAGTGAACGGCGACAGAGCGTCTTGATTGGCGGGTCTCATTTCCCGCGCTATAGTGACCTAGGAACAATAGTGACCGAGGTCTCGG
CTGGGTCTAATAAAACCCCGGCCGAGGTTAAAAGCCTCGTTTGTACCCATTTCGTATCGTACCCTCGGCTGTGTAGAGCCGGCTATACGATTTCCCACAG
AGATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCTCAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCAGCA
GTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTTGGATGCCTGTCAG
CGAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGGCGACCAGGAGTGTCGGTCCCTATATA
TTGGTGGAACCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAAACCGTATTAGGCGTGACTGCCGGTACCCTTCCTTCTGAAGG
ACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGGCCGAACTCAACCTTGGTATACA
GAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGGT
GGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACATCTGTGTCTTCGGGAGTCCCTTCGAGCTCCCCCCTTTGGTCTCCTATCGG
TCCTATGCAAATACCTAATGAAATGAAGTCGTTATAGATCTCCCTGCGACTCTTCGCTCAGCTTCCTAGTTAATCTTCGCCGAGTCGGGTCGTTATGGAT
CTCGACCGACCCTTCGCTCCGATTCCTGATTTATCCTCTCCCACTTGGAATAACTCCAAAATGGAATGCGCTCGCTGAGTCGCTGAGTCTTGGTGCTCGC
CAAGTCCGACTGCTTCGCCGAGTCCGCCGCTTAGGTGCGAACTTCGATTAGGTACGACGTACTTAGCTGAGCCAGACTGGGTGGTCTACCCAAAATATGA
GTTTCCCTACACCACAATGTGCTGCGAGTTCATCTCTCGCTACCAAGAAGTGCTCCGCAATTGTGAGCTGCGCAACCTGGAAGGACCGACCTACGCGTAT
CCGCGCCAGACGTGTTGATGGTCACTTCAGGACCTCTGCCAAATTCAAGTAGTCACACGTCACAGGGAAAATATGGTGGACACAAATATGGGCAGCAGCA
AATTACTTGTGTTCAGTATGCAGATCTAAACGTCGGCGAAAGCTACAACTGAGTTCTGGTCGAGAGCTACAGGCCCTTGAGTGAGCGCGGACCCAGCTAA
CTGCGCCCTGCATCTTCTGCCGGATGCCACCGCCTTCTTTTGCTGCGCTGCACTTGGCGCTTCAGTCTCCTGCTGCTGCAGCTTGCTGACGTGCTGCTTT
TCGCGCAGCAGTTTCCACTTTGCGTGCAGCTCTTGCTGCCGCTGCTTCCTGTTTCGCTTGATTCTTCGCTTCCGCCGCCGCCACTTTCATCTTGACGGCC
GCCTCCATCTCCTTGTATGTCAGCAGCTTGCCCCCAGAGACGTTGGCATCGACGAAGTCGCCCTTGGGACGTGGTCTCACTGCGGGCTCGATCAGCATAG
AGAGTGACAGACGTGCCACGTGAAGCGTGTCAAGGCTCAGCCGGCGCCTCTTCATGGCAGCTTGAACGCGTTTGGAGACAATTTCTCCATTGAAATGAGG
CTCCAGAACTGCGTGGTGCCGAACCAGTATCGTCGATGAGCGCTCCATTCCTGTTGTCCCGCCCCCAACCATCTTCTGTAGCATCACCTCTAGAGACAGC
GGGAAATCCCACTGTCTCTAAAGCCGCGTCTCACATTGGCTGACGAAAAGGCAGTTTCAAACGGCCCACACGCCATGCGCGCAACGTCGTCTTTGACTGC
AAGGCCCCCTCCCTGTAGCGGGAAATTTCGAACTGCCGCGTTATACAACGCTTTGTAAGGTTGAAAAACTCCGACATCCAAAGGCTGCAGAAAGTGGCAG
CCCGGCGTCAGCTTCGTCCGATATGTACACTAGCTGGGGGCCACGTCTGCAGGAGATCGGCACAACGCCGCGAATTCGAAGACGAAGCGACTCGCGCGTC
ACTCCAAAACGCTCGGCTGCTTCGCGAATGTACATGCCAGCATCAACGGCGTCGATAGCATGCTGGTAGCGCTCAGTCATTGGCACTTCGGGGTTATCGG
GGTAGAAGAGCTGCAGCATTTTGGTCGGAGGATGGCGAATGTCTTGGGGGCTCTAACTTTCATAAAATGACTCACTCAGGCATGGGCGAGAGCTTAAAAT
GCGCGGGGAGCTCTCATCTTCCTCACCAGTGAATCTGGTGCTGGTAAGACACGTTTTGTGGGTGGTATGAATGGCTGGACACAAGGGCTTGTTTTGCTTA
TTGACTTGGTTTTGTATACTTCTCCAAAACATAATCATGTCCAGACCATCAACA