Description :
From Genome Similarity Track
Location :
Scaffold_8:188093- 195460
Transcript NameFunction/comments
Phyci_77190conserved hypothetical protein
Phyci_301490Hypothetical protein
Phyci_90126Hypothetical protein
Phyci_2300Hypothetical protein

Sequence
7367 bases(100 bases per row)
GTTGCATCGACACCGGTGTCTCCGTCATCTTGTGTAGGCAATCTGTGCCCGGCATTACGAATCGGAGATTGCATCATTGCTGGAATGATGCAATCCCACG
TGAACAACGTCCATTTAACAAGAGATCCCTGCCTATAAGCTTGCCACACGCATACGGCCAATTGACCGACCCCGAAAAACTGTGACGCGATGAGTCAGGA
ACTCACTTTGCAATTTGCCTTCAGCCCAGCAGGCAGCACCCCGAAGCAAACTACCCGTTCGTTCTCCAGCCATGAGACTCGAGGATCCCGAGTCTGGCCA
GTCCACGGCTACTACGGAAGCCCAAGTCTTCTACGAGTCCGTCGCGGGCAAACTGGAAGAAGCGTTTGGCCGTTCGCAACCTCATCTTGAAATGCGCTTC
TTGGATCTCTCGGTGTCGCGCAAGGCAGCTGCGGTGAAGTCGCAGCGAGGCGACCAAGGCTCTCCAgagcttccatcgctttggaacacactcaagcacg
tagctgtgaacctcgtctcctcgaggaagatggagcaacgtgtcattctcaatggagtgagtggtatgttgcgccccggaacgatgacattggtccttgg
acagccggggtcgggaaagtcgacacttctgaaggccttgagcgggcgacttggagatcatgtgcggttagctggtgacatcacgtacaacggcgtgcct
cagcatcttgtcgccaagaagctaccacagctagcggcgtatgttcctcaaaacgatcttcatttcccgcttctatcagtgaaggaaacgctgtcgttcg
cgcatgccttcagcgctgataatggtaacgacgttcaacgacacgctacggtgctgctgggacaagatgtgggccactcgagtcaacaggcactgaagtc
tgctatcgacatgtttgagaactaccccgaggtgatcaagaggcagcttggtttacagaactgctgggatacgattgttggaggtggcatggagcgtggc
gtatcaggtggggagaagaagcgcgtgacgacaggggaaatggtcctcgggatgcagcgtgctgtgttcatggacgaagtcagcacggggcttgacagcg
ctgcaactttcgacatcgttcacacgcaacgctccatcgcacgaagccttggcaagacaatggtgatttcgctgttgcagccatccccggacgtgtttgc
gctcttcgatgacattatccttctgaacgagggggaggtgatgtattatggacctcgcgtgatgattgtggggtattttcgtgagctgggtctcagttgt
ccaccaaatagagacgtcgcggatttcttacttgacctcggaactccgcagcagtatccctatgaatccccgccggttgctgggacaagggttccccgcc
tagtgaacgagttcgcggacatgtttcgctcgtcgaccactcaccggggaaaccttgctctattgacgacttcactcaacgatgagagttcgggcacgtg
gagcaaatatgtcaactcgatgccacagttccagcgctctgtttgggcgaacatacatacactcgcgagtaggcagctcaagctcaccctgcgtgacgtg
aatacgctccgcagccgagttgttcttgtcctcgtggcagcgctggttacagggacagtttttatggacgcaaaaccaacaaacgtgccactggtgctcg
gagtgcttttcatctcgggaatgtttccgctctttgagcagacttcacaactctcgatgtttattgagatgagggatctcttctacaaacagcgatcggc
gaacttttttcagacgtcggcgtacgtgctcgcgaacgtcatcagccaagtaccagtggcgttgccagagagtttcatttttggggccttcctgtactgg
attggtggtctagaggcaagcgctgggaggttcattgtgtacgagatcgtcgtctttctcatcgtgatggctgctgttctcattttcttcttcgtcgctg
caatttccccgaacatctacgttacaaatccgcttgccctgggaattcttcaagtcatactggtgttcgcggggtttatcgtaactagagaccagattcc
agactacctcatttggctttattggctcaacccaatggcctggggtttccgcgcactcgccgtgaaccagtaccgatctccaacgtttgacgtgtgcacg
tacgaggacgtggactattgcgcacaattcggtaagaccatgggcgagtactacttgagtgtgtacagcattccgtcgcagaaggagtgggtggtcctcg
gtatagtttatctcatcgggttgatcctcgtattcacggcactcagctacctcgcactcgaatacaagcgatatgaaGGAGATTTCAGAGTGATTCGATC
TGCAGTGACGAGCGACGAAGACGCTGACCATTATCAGCTTGCAACAACTCCGAAGGAAAGCAGTCGATCTACACCTTCGGCTTCATCGGGGAGAGCTGTA
TCGATTGAAATTCCAGGATTTCCCAACGCGttcgtgcctgtaacagtggcgttcaaggatctgtggtattctgtgcccaacccaagcaacctgacggagt
ccatcgacttgctgaaaggaatcagcggggtggcacgtccggggaccatcacagcgctcatgggctcgtcaggtgccggcaagacaactctcctggatgt
tatcgctggtcgcaagaacaccgggtctatcaggggtacgatcatgctcaacggccacgaggcaacggaacttgctatccgtcggtgcacaggatactgt
gagcagacggatattcattcggagacggcgacattccgcgaggcactcactttcagtgcctttctccgtcaagacagtgacgttcctgcgaggaccaagc
tcgactctgtgaacgaaatcgtgaatttgctgggtcttgagaatgtggctgatcacatggtacgcggcagttcgctggagcaattaaagagactaacaat
cggtgtggagctagcagcccagccgagtgtcctctttctggatgaaccgacgagtggcctggatgcgcgcttcgccaagatgatcatggacggaattcgt
aaagtcgccaattctgggcgtacaattatctgcacgattcaccaaccatcgtacgaggtcgtctccgttttcgacaatttgctattgctcaagcgtggcg
gtgagactgtatactatggcgagcttggggaagcctgccagacgctggttgactatttcgagggaatcccaggtgtgcagccgctgcccgaaaattacaa
ccctgcgacctggatgctcgaatgtatcggcgccggtgtcaacaaccgggtatccgaaggagatgacaaagatttcgtgcagcgatttaacaagagcact
ctcaaatcacacctggatgcgactttggaggaggacggcgttgggcgttcgtcgcctcacgccccagtcttgaccttccgccgcaagcgcgcggcatcca
ctgtcgtgcaactgaagttcttgctccatcgcttttttaacatgtactggcggtctccagcacatagtctcacaatactcggtgtggcgcttggaagttt
gatcgtgttggggcttgttggcatgggtttgtcgacgacctcgttccagggagtagcctcgggtctcggcatcatcttcgtcgcgttccagttccagggg
ttcgtgtccttcaacagctcaatcccgttcgctttcaacgatcgcgcagctttctaccgcgagaggtctgcgcagacgtacagctcgttgtcgtatttta
ctgctggaacgttcgtggagatcccgtacgtcttcacgaaggggttgatcatctcggcgctcctgtttctcttcatggggtttaccggcttcggcaagtt
ccttctcttctggctcgccctgtcgctctcgattctagtggacgtttactcgggccacctcctcgcattcctgctgccgaacatcgtcatggcgtcgctc
gccgggtccgtcgtctccacggtcttcttcctcttcgtcgggttcaatccccaaggcagctccatctccgccggctaccagtggctctacaccatcaccc
cgcagcgctacgccatgtcaatcctcgccacgctgacgtatggcgagtgctccacgagtccgcagctggacgcaagcacgggcgactacaccaacgtcgg
ccccgagatcgggtgccagcccctacaggacgcgccgctcacagtcggcaacgcgacggtcaaggggctgctcgaagacgcgtacaacatgcggcgcgac
gacgtcgggcgcaacttcggggcgctgctggtcttcgccgtggtcttccgcgtgctcgcactcgcggcgctgcagttcctcaaccaccagaagCGGTAGG
CCGTAACGGACAACTTCAACAAGCGTCACTAAAGCACAAACGCGACGTCACTAAAATGAATATAAAATCTATAGGTTCCTGTCACATCGAATTAACTGTC
AGAGATAATTCATTGGCCGAAATGCGCAAGACCCGACGTATCATTGGCAAAAAAAGGACGGATGGTACGTGGTACCCATTCGAGAGCACTTCCAGCCATT
TATCTCCACAGTTAAAGACCAAGTGCTGCACAACCGATCGATCATGTCGTCGCTGCGCAACGTGGTGAAGCGGCGCGAGCACAAGGAGCGCGGGCAGCTG
CGCGAGCGGCGCAAGCTGGGTCTGCTGGAGAAGCACAAGGACTATGTGAAGCGCGCGCGCGACTACAACCAGAAGCAGAAGCGGCTGCAGACGCTGCAGC
TCAAGGCGGCGCTGCGCAACCCGGACGAGTTCTACCAGCGCATGGCGGACGCGCGCACCGAGGGCGGCGTGCACGTGTCCACGCACAACCACGCGAAGCA
GCTGGGCTCGGAGGCGCTGCGTGCGCTCAAGACGCAGGACCTGGCCTACCTGCACATGAAGCGCGCCGTCGACCTGCGCAAGGCCGAGAAGCTCAACCGC
GGGCTGCACTTCGTGGACGCGCCCAAGGGCAACCAGCACACAGTCTTCGTGGAGGACGAGGCGCAGCTGGAGGAATTCGACGCGGCCGCGCACTTCGACA
CGGCGCCCGAGCTCGTGGACCGCGCCTTCAACCGCCTGCGCACCAAGGACCTGCAGACGGCCGAGCTCCCCGACCTGGCCGCCAACCCCAAGCAGAGGCA
CAAGGCGCAGGTGGAGAAGGACGCAATGTACCGCGAGATGCGCGACCGCCTGGCGCGCGCCAACAAGATCGGCCGCATGAGCGCCAAGCTCGACCTGGAG
CGCAAGGTGCAGGCCAAGGGCCGCAAGAGGAAGGTCAAGGCCGCCCAGGACGGCATGCCCGCCGTGTACCGCTGGAAGCAGCAGCGGCAGAAGTAGAGAG
CAAGCGGGGTACACAGTAGAGCCTATTGATTTCATACATGCATTTTTTGTTGTTAGGGGGTTATGCTGCGGAAGAGTGCGATtgctgctgctgctgctgc
tgGTGTCGGTGTCGTCGACGCGGAGCGTGGTGGTGGCCGTACGCCTTCCGGATTTGGAGCAGGAGCTGCAGGATGACGCCGCGGTCCCCAGCGTAGATGC
CGGCGGCGCGACGGAGAAGGTGGAGTGGCATTGTCTGTGGGAAGACAGAGGGGTTGTTACGAGGAGCAGGATCGGGAACGGAGAATGCAGACGGCAAACC
TTCTTCTGCTGGAGGATGGCCAGCGCTTTGGTGATGTTGTGCAGCGAGCTGGCTTTGCTGAGCGGCTGCTTGCCGGACGGCCGCGTGATGCCGGGGATGC
TGCGCATGAACTCCACTTTCTCGACGATACAGCACAGCAGCACACCGGACTGGAATTCCCTCAGCGTCGCAGATGGATCCTGTGCAGTCAAGAATAACGT
GAGTATGAAAGGAATGGGCAGTGTGCTTTGCGTTCTTACCTGGAGCGCGGAGGCGTTCTTGAGGTTGATGTCCAAACGTTTCAGCCACGATAATATCTCC
TCGACAGGTTCTCGCGGTAGCGTTGATGTCAAGTATGTTTGTGCTGTTGGGGACTTGGTTGGTGAAGGCTCAATCACATGTCCACTGCTGCTTGGGCCAG
TCGTCTTTGTGGGGTCTGCAGTTGGTAACGGGGATATATCTTATCTTGCACAAACTCGTTAGTACGCTTAGTACTGGTGTACATGTGCTGAGTGCTCAAG
TAGGCACGCACCCGATAATTCTGATAGCGCGATGCTTGGTGCTCGCAACTCTTGATCCAGTTTGCTTGGAACCACCGCCACAGTTCTAAAGTCGGTGCGA
ACAGGTAATATATCCATGTCCAAATCGTACTCGTGAGTCCTGGGCGTTTCCGGGTAAAATTGTTCGCTGTATACTGGGCTGGAAAAGGGTGCCTTTGGTA
CAGGAAACAGATCGTCGTCGTTGTCATCATACTGTGGATCATGTTTGCTCCACGCAAGACGGCGAGCAAAGCTTTCGTGAAGTTTAATCTGAATTGACGT
TCCTTGATCAGCTTTCCCCGCGAGTTTTCCCTGTCCAGCCAAGGTCACAGCGGGGATGTCCAACAGCAACGGAGAAGGATGTACCAGACGTGATACCTTA
GTTTCTAACTTCCTCTTCTCCTTAGGTCGCGGATGTTTCGTCGTGGATTCATTATCCGCGCTGGCAGCAGGTGAAGCAGATTTATGACTCTCGCGAAATA
CTTGCCAGAGGTGCCACAAAATCCCGTAGTTAACTTGTCGATCACCAATGAGGACAGCTTGCTCTGCGGATGGAGACAAATAGCACCGGGGAATCTGCTC
GCGTGGTAGCTCGCCAAGCTTTTCAACAGCCTTGGAAATATTTTCCCTATTTCAGATAGTGAACAGGTGGGGTCGATCAGCGAAAAGTGCCCTGCCCTAG
ATCACATAATTTGCCTACCGCATTTCTGTCAATGTTCGAGGAGTTTTGAAAAACGGAAACGACGTGCACTTTAGAACTTGAGTCAATAAAACACTACAAG
CAACACGTCATTAGACACATGGATGTTCCAATTCAAAACAGTAAATGGGCAATTAGCTACCAGAGCAGAGAACCATTGCGCATCGAATCCTGCAAGACAC
CACAACTTGCAGCCTACACTTTGTTAGCCGACTCAACAGATCAGTCTAAATAACAAAACAATCTTACTTTCTTCGGATCGAATCCGACAAGCGTTAGCCA
CTCGTTCACTACATGCATCTGCTCACTTGTGATATACGGCAGGTTTCGTTTCAACGGCGCACACTCGGCAAGTGAAGAATCTACCACTGCGGGTTTCCTT
TCTGTGGCTTGAGCTATCGGCACGCGCGTAGGACTGGTACCAACAACTCCCTCGACATGTTGACTAG