Description :
From Genome Similarity Track
Location :
Scaffold_47:188087- 189098
Transcript NameFunction/comments
Physo_136651hypothetical protein

Sequence
1011 bases(100 bases per row)
GCTGCCAAGTGCTAGTGCGACCCTAGCTGCTGCGTCTGATAGTTTGGGCGTCCTCTCGAGATGGCATGGAATGAACGCTGCGCTCTCAAAGTTGGCGTGT
GAATACCTCCGCCTCCCCGCCTTGATGCATGGGTCTGGCAAGGATGCGTCGCAGACTGAATCGATTGAACAGCGCGTGTGTACGTACGTCGTCACTACGC
TCGCGAAGTACAAGGAGACGCCGGAGCTCCGTGCGGTCGCCAGCATGCAGAATGTGCTCCAGCCTCTGCTCGAGGTTGTGACGCTCATCTTGGCGTCTGT
GTCTCAGCGCAGCGAGACCCCTTCGTCGGCGGAAAACCAAGGTGACGAACGCAGCCTCTTGCTGGAGGCGGTGACTCAATTTTACGCGCTGTGCACGCCC
AAGTCGGTGAGCTTCCGCAGCTGCACGGCGTTTGTGGTTGAGCAGTTGGAGATCGCGTTGCGTGGGCAGCAACGGCCGAGCCAGAAGCTGCCCTGGCCGA
TGGTTATGCAGTGGGTGGTGTGCCTTGCTGACCTGCTGGGCCAGCTCGACCCGCAGCACATGGAGCTCGGCAGGCGCAGCTTGCTTGCATTGATCTCCGT
TCTGAAGCAGCTCCCGACTGAATTTGCCAGCGGAGAGCAGATGGAGAGCGTGCTGAAGAACCTGTCTGCGTTCTTCGACCTAGCTGCAGTGCCGTCTCCT
TCGATGACAGAAGACGAGAAGCAGAGAATGCTGGCCAGGACACGCTTCGATGCGCTGGGTGCGGCGGATCAGCTGGTGTTCGTGGCGCTGGTGTACCATT
TACCTCGGTATCCTGTGTCGCTACTGCGTGCTCTTGCAAGCTGCTGCAAGAGCCCTCGCATTTACAGCGAGGCGAAGAGTTTCCTGGTCGACATTCTGTT
CCAGCGACGCGAGGCTGTGGACCTTGCTCACATCGTGAGTTTCCTTGTGAGTACCACGCTCGCGCCTGTTGATGCGAACGCGCACCAGCAGCGCCAGCAA
CTGCAGCTTGT