Description :
From Genome Similarity Track
Location :
Scaffold_255:18800- 20117
Sequence
1317 bases(100 bases per row)
CCTCCTCCTCCCGACCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGATCCCCTTCCTACTCTTCTTCAT
GAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCACCTGGG
GTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATTCGTCCGTATCTAGTTCGCTTCCCTGGCCTCATGTCGGTGATCTTCTCGACTTCGAA
CTCGTCGGCCTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGCACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGGTTTGCGGC
CGATCCGGGTATTCCTTGACCAACTTCAGCTTGGATGCGTGTACTTCAGGGAACAAGCGATATTCGGTACCTGCCGTTCCCAACTTTACAGCATGTTTTC
CTATCTTCTCGCTCACCCGGAATGGTCCGTGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGATCTAAATAAAGTCACACCCGCGATCC
CACTTGGACTTGACGTGGACGGGCGTCTTCGTTGTGTCGATCTGCTCGATCTTGTATCGCACTCCGCAGCCGTTCGTTCACTTGGGATCTGGCTTGCCGG
TAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACTGGAATGGCCGCTTCTAGGGTGGATTTGGAATCGC
ACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGACGGTGTTCATCGCGAAGGGGAGTCGCTCTGCGTACTGATCCCAATCCCTCTG
ATCCAAATCCTGGACATACATCTTGAGTGCCCTCGTGATCGTTTGCATCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCCCGC
TGTCTCTGCCCCAGGATCCGGCTGAAAGCTCGAAAGAAATCAGACATAAAGCCTGGCTTCCGATCATGCCTAATCATCTCACTAGCCCCAAATCTTCGGA
AAATGCACTCCTCGTACGATTCGGCAATGGTTTGCGCAGTTCTAGATGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGATCCACCCAAATCAACAA
CTCTGCGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGTTCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCGGGCGACTCCCCT
TCGATTGTGGGCCTGCC