Description :
From Genome Similarity Track
Location :
Scaffold_27:1880- 5059
Transcript NameFunction/comments
Phyag_g741vacuolar protein sorting-associated protein, putative

Sequence
3179 bases(100 bases per row)
GTACAGTTCACGAAGAACGAGAGTACGGATTACTCGACTGTGGCCAAGTATACAGTGGAAGCGGAGGTAGGCGCGTTGCAAGGAAGCTTGACGCGCGAAC
AGTATGAAGATATGTTGTTTCTGCAGCGAGCGTTCTTGGGGCGACGAGCTGTTGAAGCGCATTTTGCGTTGGCCAGGGGAAGGCCGTTGCATACGCCTGG
AGCACGGCCTCGTGAATGGTGGGATTATGCTACTCGTcttgtgctggagcagcgcaGAGCGAAACTTCGACGAAAAGCAGCTAAAGACAAGGATAAAGAT
GCTGTTGCACACCATACGAAACACCGAGGACCGCACCACCGCAAAATGCGATGGTCTTCCGTACATAAAGCGTTGTTGGAGCAGCAATTGTACATTGATG
CCTTCCGAACGGAATTACGCAATGGTGCTCCGTTGGATCCCTCAACAAGACACGGCAAGTTCAAGCAGCGGTATGAAGAGGTTTACCCGTTGGATGTAGT
TTTGCTGCTACGCGATGCTGCGGAAGATGCCGAAGAGCGGGCACAAGAAGAGGCGAGGGCTTCCGCAATGGCACAATCTAAGACCCAGGCTGCACAAGGC
GGGGGAGGTTCATGGTATTCATACTTTTTCGGTGGTGAAACCGATGATGTAGCTGCATCAACtacagcagaagaagagcatgtACTTTCAGCTGAAGGTC
GAGAGAATTTACGCGAGGCCTATAATGATGCAGTGGAAAAGGCCAGCACTGCGCATGAAGTGCCGATGGGGTGCAACCTCATGTCGATTCAGATCCAACT
TACGAATGGATCGATGTCTCTCTATCAGTCAAACGCTCACGATAAGCCCTTTGTCACCGGCAAGCTCCACGGTTCTCTAGCCGTGAACGTTCAACCAGAA
AACGAGTGGGACGCAAAGTTTTGTGTGCAGCATTTTGACATCTGCAACGGACTAGCAAACAATTCGCGATTTAGCTCGTTCTGCACCCCAACCACGGTAC
CTGCGTCACGTGACAACACGTGCGAGTCCTGCGTCAGTATCAAGGTTAGCAGACGAGCAGTCGCGCAAACTCAAACTCtgggcgacgatgacgttgTAGC
CACGCTAAATGTCCGCGTGCGCTCCGAGCCTATCCGTGTGATGGTCGACCCTTCTTTCGTGATGTTCCTGCacgccttcttcgtcagcttgTTGccggag
aagcagctcgagagaGTCTGGCAATTTGCGACGTCATCTGTAGCCGACTGGATGTTCACCGATGATTCTGCAGATGAAACGAAGCTATTAAAGTCATCGG
ACCACAGCGCAGAAAAGAAGGCCGAGGAAGCGGAGCTGATACGTTCGCTTGAAAGAGCAGAGGGACGTGTTGCCTACGATGTACTGGTGGACATGGAAGC
ACCCGTGCTTATTCTGCCGGAAAACGTGGCCGAGTCGACTGGTAATGTTGTTGTGGTGGACCTCGGTACTTTAAGCTTTCggaacgacgacaaggtgaCT
GATATCGACACCTCTTTAGATATAGGTATGGCGCTTGACACTGCCCCCCACAGATTACACTGGCGGTTAGAGGTGACCCAAATCCATGTCTCGCTCGGCC
GCCAGGAGCAGCTAGTAGAGTGGACTGACGAAGAACTCCGTAGCTTCACCAAAATTGTGAAGGAGCTATCGGTGGAGTTTTCGCTGCATACACAGGCATC
GGGTTCGCGTCTCAGGCTCCCATCTCGGGAAGGAAGGAACAGAGATTCTGCCAAACCACTGCCTCAAGTGGGTGTCTACGCTGCGGTCCCTAACATAGTG
GTATCATTAGCTGAAGAACAGCTTGTGGCGCTAGGCCAGATCCATTCATCCATAGTGATGCAAGCGGCTACAATTGCTCGAGCCAACGATAAACGTCTAG
CGTATTTTGAAGAACAAGAGCATGACAGCGGTGAGGAAAGCGCGACGGAGACTGATATCTCAAGCGGCGAGAGTGCGAGTAACGtggctgcagttgctgc
tacGGTGGAAGAGAAATTCCTCTTAGAGATGGAACTTTCGCTGGGTTGCGTGGAGCTGAACCTCCGTGAGTCGACTGCAAAGGACGCCTTTTGCTTGCGT
GCTTCACATACTTCCTTTGCAGTAGAAGCGTATTCCGCTCACCAAGTTTGTCATGCTCGGCTGAAGGCGCTCGTAATGGAAGACAAGCTCTACTCACCTG
GTTCACGTTACTACGAGCTCATTTCCACTGGCGAAAGCGAAGGCGAAGCTCCACATTTAATTGCCATTGACGTCACCTCATTTTCTCCGgagtctgcagc
gccaagaagcaacCAGGCATTGGAATTGGAAGCTGACGTGCAGTTTAATGTCCTGCATGTGCAGTGGAATCCGTCTTCCATTGCACTGCTTTATCGCATT
ATATCTGCCTATGCGTCTGCCATCCAGTCTCATGACGATGACTTCCCAATTGAAAACGCTACAGCGTCTCCAGTATTATCTCCAAAGAAGCTTCTACCAG
AATCTGCAGCTCGGGTTAAAGAGACTCAGAAGGAGAGAGTCGCCACTCTGACTAGGCTGCGTTCACGAGGACAGCCTCTGGCTGTGGTGCGTGCATCGCT
AGTTCAATTCAGCCTGACGTTTAACAAAGATCAACTCGACCGACAACTAGCACGGCTAGAGATGAGCAATGCGGCAGTCAATTACACGAGCTACAACGTG
GAAGGTCAAGCTTCCACTGATGAAGACACGTTCGAGATTACAGGTCACGTGGGGAACTTTGTCGGTACGGACTTGAGTACATCCAAACACCCGCTGTATT
CGACGTTACTTGGATTGGATGAGGATGTAGCTCATTGCCGTAGCACCACCAGTGACGAATTAGAAGCGCTGCTGATCTTTGAGTTTGCAAGCGACCCGAC
GATAAGCGACAAGAGCTCTCTCCTCCTGGCGTTTCAACCGATCCGTGGCGTTTACTACCACCAACAAGTCTTGGAACTTGTCGACTTCGTCCTTGAGGGA
GTCCTTGGAGCGATGGTAAGCCAGACACTGATGAGCGCCACGCAGCTGTTACTCCGTGAAGATGAGGCCAGCGTTGTGCTCGATCTGAGCGTTAAGAAGC
CCACTTTGATTCTCCCGTTCAGCTTAGAAGATGCTCCTCATGCTAAGGTCACCGCGGATGTGCTGCGTCTAGTGCACTT