Description :
From Genome Similarity Track
Location :
Scaffold_276:188- 7384
Sequence
7196 bases(100 bases per row)
ACGTCGACGTCAACGACATCGACCTGGAGGAAGAAGAGCTTGACACCGACGACCTCGAGGCCGCTGGCTGCGCGGTTTGTGCCCTCGGCGCGCATCGTCC
TCGCCTCCCCGTCGCGCCCCAAGTCCAGCTTCCGGCTTCAGGCGCCCCCGTCCACTCGGTGACTGCTCTTGTCGCCGACGCGCACACTCTCCAGCGCGAG
AACCAGGAGCTGCGCGCCCAGTACTAACTCGTCTCAGCGCACAATGCGGGCTTGGCTACTCACGCGTCCGTGCTGCATGACCGCAATCTCGCGATCTTGC
ATCGTGCTCGCGAGGGTTATCGCGCAGGCATGATCCGGCTCGAGCAGGCGCTCCTCTCCCGGGAGCACGCCGAGCGGGACTACGCCGTCCTGGAGGACCG
AGTGGCCGACTTCCGCGCTCGTGCTGAGCGTGCCGACGCTGCCGAGGCTCTACTCCGCGCCGAGCGAGGCTCCTCGACAGAGCAATATCGTGATCTTCAA
GCTCAGCTCCGGGCGGCACGAGACCAGGTCACTGACTTGACTGCCCAACTCGCGCGCGCTCCTGCTACGCCGCCTCCCTCCATCGTGTCGCTAGCGCAGC
TGTTTGCTGCACAAGGCGAGCGCGACGACGCGCGCGCCGAGCGTGACGACCTTCGCGTCGACCTCGCAGCCGCCCAAGCCGCCCTCGCTCCTGTCCAAGC
GCGCGTGGCCGCCGCCGAAGCTGAACGAGATCACATGCGGCAGCTCGTGGCCACTGCCGAGCAGCAGCGCGACGCCGCTCTCGCTGAGCATGACCGCGTG
ACCCGCGTTCTCATGGCCGTCGAGCAAGAGCGTGACGGGGCCCTCGACATGCGAGATCAAGTGCGTCGCGCCTCCACGGCCCTGAGACGCATGCGAGACG
CTGCTGTCACCGAGAGGGACCGGGCACGCCAAGCCGTGACCGCCCTTGAGCAGCGGCGAGACGCTGCCGTCGCCGAGAGAGATCAGGCTCGTCAGGCCTT
GACCGCTCTGGAGCAGCAGCGCGCCCCTGTCGACGAAGAGCTCCGCGCGGCCCGTGCGTCGCTTTCTCAGAGCCGCATGGAGATCGAGGCGGCCCAGTAC
CTAACGTCCCGCTGCAGGACGACCTTCGGCGCGTCAACGCGCTCGTAGTGGCCCACGCCTAGGAGCTCCGCCGCGACGCGACGCGTATCCACGAGCTGGA
GGAGTCCGTGGCTACTGCTACGACTCTCCGTGTGGCCGCCGAGTCCGAGATGGCGCGGGCTCAAGCCGGCGAACTTTGCGCCACATCTCGCGCGGCGCAG
TATCGAGCTGGGTGGCTGTCCATGCGGCGGTCGTCTCAGCAGCGTCGAGGAGCAGTCGGCGCCCAGACCCATCGTCTCAGCGCTCGTGTCGCCGAGCTGG
AGGAGGAGCGCGACTTGGCCATCCGAGAGCGCGGCGAACGCGCTGTGACTTGGCGTCGGATGCTTCGAGACGCGCGTCGGGGCCGAGAGCTGGCGCGGCG
GGTGTGCGACGAGCTTGCTGATCGTCTCGCCGGCGTCGTAACGCATGTAGGCGGGCAGATCGACACCGCTGACCTGGTCAGGCGACTCGAAGCCACTTTT
ACGGCGGAGATCGACGGTGCGATCCCCCTCCCCCCTGCTATTCCTACGTCCGCAGCAGTTCCTGTGGCATCCGCGGTTCCTGCTCCTGCTCCAACTGCGT
CGAGCTCTGGTGCCCGGGCGGGCTCGTCGGCTTTGACGGCGGGCTCGACGACTGGCGCTTCCCCTCCAGCAGGTCCTTGGGGCTCCCGTCCTGTTCCGAC
TTCGTCCGCTGCCTCGTCCTCGTCGGGTTTTCGGCGACCTCGACACGGCGCGTCGAGTCGTTCGGGTTCTCAGTCACGCGCGTCTAGGCCGTCAGGAGTG
GCGTCCGCTACGTCGCCTGGTTCTTCGCCCCTTCGACGTAGTCGACGGCTCTCTACCGTGGCCGACACTGCGGCCTCCGACAACGCCGCTGCGCAGGCCT
CATCTGCAGCTACGCCCTCTACGGCCGCTGCAGCGCGCGCACGAGAGGACGCGTCGCTCTTCGGCTCCGAGTCTTCGGACAGCGAGGACCAAGCGCGGCG
AGCTCAGTCCAAGCGCCGCCGGCTGCATAGCCCTGGGTCTCGCTCACGGTCGCTGGCGCGTCCGCCTCCACGTTCGCAGTCACGTTCCCGGACACCCCGC
GCTCCCGTTCTGCTTCGCGTTCGCGTTCCCGCTCGGCCTCTCGTTCGCGTTCGCACTCGCCTCCACGCTCGCGCTCGCGTTCTCGCTCGCCCTCCTTGGC
GTCGACGCGTTCCGTCGGCTCAACGCGTTCGGCGCACGCGGCGGGGTCGGCGCACTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTATCCAGGCCTCCAGCACGCGACGTTGCAAGTCGCGCTCGACGACATCGACGCGCAGGAGCC
CTGGCGCCGGTTCTATTGGACGCCGCTCACTGTGGCCGAGATGGACGCGAACGTACGCTGCCGAGTGACGCGCGATCACCCAGCCTTCCATGTGCCGCGT
CTTGCAGGTAAGTTTGTCCAGCAGGTTTGAGTCTTGGCCCATCGTTGCAGTCCGTCGCGTTTAGTTGTTGTAGCCGTAACTTCAACACGTAGCCTTGATC
TTTCCCCTTGTTTCTTTCCACTTCTCCACATCTTTTATGAGACGGCCCTCCGCCGTCCCATCTTCAGCAACAGGCTGGTCCTCCTCACTTCCCTCATCCA
ATCCCTCGCTCCGGCCATTCCCAGAGTCGAGGCTTCCCACCAGTCCTCCCGTCGGCAGCCCCCCCCCCCGCCGACTTAGTCGCACCCGCGGGCGCTCACC
CACCAGGCTCCACCGCCTCCGCGTTCTCGTGCGACTGCATCGCCTCGAACCGGTTGCGTCCCGTGCGCTGGCGCAGGAAGTCGTACAGCAACCCGCCGCA
ATTCAGATCGAGCTCGTCGACCCACGTCGTGTCCGGGTAGCCTTTCCATTTGACTTCGAACTCGCGTCGCGTGCGCCCATACCGGGTAGTCCGCCCCTCG
CGCACATTCACGATCTTCTCGACCTCGAAGACGTCGTCCTCCAGCTCGCGCGTGGCTTCCCAGCTATCCTCGGGCAAGAGCTCCTCGTCGAAGTCGAAGC
GCTCCTCGGCCGGCACCGTCAGCTGCGTCGCGGGTCGCGACGGGAATTCCCGGACGGGCTTCAGCTTGGAGATGTGGACGACGGGGTACAGCTGATAGGG
CGTACCCGTCGTCTCGAGGCGCACTGCGAACGCGCTGACCACCTCGGTGACGCGGAAGGGTCCGTGCCACATGTGCGCGAGTTTGCGCGCATACCCCGGC
TTCACCCGATCCAGGTACAGCCAAACTTGCGAGCCCGTCGCGATCTCATGTCGCGTCGCGTTTTCAGTTTGTCGACGCGCTCTCTCTTCGACGGCCTCTC
GGACTAACTCCAACGCTTGTGCCCTTGCCACCTTGTAGTGTCGCTGAATACGGAGCCTCCACCGCCGCGCCTCGGCGTCCCGGGTCGACGTGTTCCCGAC
GGCCAGCGTCGACCGAGGATCCCAGTCGTGCACTAAGAAGAACGGGGTTTCATTCCTCGTCCGGTCGTACGACGTGTTTAGTGCGAAGGTAAGACGCTCG
GCGTATTCGTCCCAGTCGCGTTGGTCGACGTCTGCGATGTACATCTTGATCGCTCTTGTAACCGTCTGCACCATCCGTTCTGCAGCACCGTTGGCTTGGG
GACGATAAGCAAGCGTCGCTCGCTGTCTCTGACCCATGATTTTGCTGAACGCTTTGAAGAAGTCGGACATGAAGCCCGGCTCGCGGTCGTGGCGGATAGC
CGGGCTCGTGCCGAAGCGCCTGAACACCGCCTCCTCGTACGCCTCGGCCACCGTCTGCGCGGTTCGTGACGCATTCGCTTTGACCACGACGAACCCCGTG
AAGAGGTCGACCCAGACTAACAGCTCTGTGTTGCCTTTGTAGGATGCCGGCAACGACGGAATATGGTCCATGGCAATGACCTGGAACGGGTACGTCGTGA
CGATGTTGCCCGGCGACTCGCCCTGGATGGTCGGCCGACCCTTTCCCGTCTCGCAGTCGGTGCATTCGCCGACGTAGCGCTGGACGCTTCTGAAAATCCC
TGGTCAATGGAAGTGGCGCCTCACGCGTTGGTACGTGCGGCCAATACCCTGGTGTCCGCCTCCAGGCTCGCGTGATAGTGGTGGAGTACATCTTCCCGAA
GAGTCTCCGGGATCAGCTTCATCATCACATCGCGATCCTCGGCGGAATCGTCGCTTCTCGGCTGGTAGTAGAGCAGCCCGCCTTCGCCCTCTTCGTACCG
AGGCGCAAGCTTTTGGCAGTTCTTCACCTCGCGCCGAGATAGGTCCCCGACGTCGCCGCGGAGATACTTCTTGAGGTTGACGATCCAGACCTCTTCGTCC
TGGGCGACGCGGATGCGGTCCAGGCGCATTCGTTGCACCACCAGCTCCTCCAGGACTTCTGGAGGTCGGACCCTACGTGTTGTCGTGCGTGCGGCAGCCG
AGCGCGTCGTCACAGCGAGGACTTGTGCTGTCCCGCGTCCCGCGTCCATGGCCTTCCCGGCGGGGTCATCTGCGCCGCGATTTTCCGCGTCGAGGTTTTC
CGCGTCAAGATTATCCGCGTCGGGACTGGCTGGAGACGCCATCCCGGGACTCGATGTCCGCGGTCGGATGACTTCTTCCAAGCGATTCAGCGTCTTCAGA
TCTTGAATCTCTTCGGGGCTGTGCGCGTTGCGGCCTCCTTGACGCTGCAGAGCTTGTCCAGCCAGCATGTCGGCACTCGCGTTCCAGTCTCGTCGTACGT
GGAAGAGTTCGTGGCGCGGCCATGCCTGGAGTGCGTTTCGCGTCTTTTGTCGCAGCAGCTTCAGCCCCGGGGACTTGCAGTCCATCTCGTCCGGCATCTG
CCTGATGACAAGGTTAGAGTCTCCGCATACGACGAGTCGGGTGACGTCGTCGAGTTCCTCTAGAAGAGAACATCCGAGCAGCCGCCCGCGGTATTCCGCC
TCGTTGACCGTGAGGTCCGTCGCATATCCCGACGCGGCGCGCACGCTGGCGTACACGATCACGACGGATTCTCGGTTCGCGTCGAAGTGTTTCAACATTG
GGGTCTCGGCGAGTTTTGCCTTGAGCGCGTCGAAGGCGCGCGTCGCGTGCATCCACTTCTCATGCCCGCGGACTTCTGGACGCGTGACGTACTCGTTGAA
GTCGGTCTCCGTCAGCGAATACACCGTCGAGTTTTGGGTCAGCGAGTTCCGACTCCGGCGATTCTTCCATCGCAGCGCTTCTAGCCACAGTCGGAGGCAT
ATCGGGTTCGCTTTCCACCGCCTCCTCGTCCGTATCCGGCTTGTGGTCGTCGGGTGGCAAGTCTACCCCCCTTCCCTTCGGCGCTTCCGCGACAGCCGCC
AACACTGGGGTCACGGCGCGTCGCGTCCCGAGTTGTCTCGGCTCCGGGCGCAAGATGGCTTTAGGCGTCGGGTATGAGGGGCGATCCGTCATCGGTCCGT
CGAGCTCGGCTGGGATCCAGTTCTCCTCCGCGTCGCGTGTCGCGCCGTACGCCAGATTCTGCCACTGCTGGTACCGGGTGGAGCCCAGTCGGACGAATCC
ACGAATCCGAGGCTGGCCGTCAGACGGCGTCCACCACCCAAGCGTTTCATGCGCGTCGAGGATTATCGCTGCGTCTCCGATGTTCGTGACACGCAGGTAC
GTTTTATTTCCGACTCTCCCCTTGACAAAGGTAGTCACCCACGACTCTGCCCGTGTCACCCACAGGAACGGTGCGTTTCGATCCGGCCTCAGCAAGACTT
CATGCGTGTCTCCTGGTTCGAGCCTCACAGGCGTCTTGACGTTGACCGGGTCCATCCGTGCGCCGTATAGCGGTCTTCGTCCGATCATCTGGCTATGCAC
CTCGTCGGGAAGGCACGTCGTGCCGTCCGCAGTGTCGATACGCACTCCAGCGGGCACCATGAAGTTCATTCCCAGGATTGCGTGTTGGCCGACCAAGTCG
CCGACCACAGGTGCATGTAGTACACCAAGTTCCCAGCCAAGGTAATCTTGACTCTGGTTCTCCCCACCGTGTAATATGTCTCATCACGAATTCCCACACA
CTCTTGCGTGATCTTCGTGTCAATCAGGCAGCCTACCTCACGAGCAAAGGTGGTGTCCAGGATGGACACCTCGGCACCTGTGTCGAGCAATAACACAGCA
CGGCGGTTGTTCAGCTTTCCATGAATCTTGGCCTGCTTGTACCACTTGTGCGGCGCGTAATGTTTCCAGTATCCGCGTCGCTCTCCTGGTTGCAAGTCGA
TCTCGTCCAGGGGTGGTTCACGTGCAAACTCGTCGTCCGTCGTACGTCGGACCGCCGAGATTCGCGGCGCGCATTCTTGTGTGGTACGTTCCGGGTTGGA
TTCACATGTATTATCATTCAGGGAAGTCGGGCTCTCACTAACCACCTCTCGCGACTTCTTGGTCACATATGCATAGACGGAAACATGTCGCTCGTC