Description :
From Genome Similarity Track
Location :
Scaffold_152:188- 3845
Transcript NameFunction/comments
g6764.t1hypothetical protein

Sequence
3657 bases(100 bases per row)
CTCGGCCGAATGGCGGCCGGCCTCCTCTTAACGGAGACACCCCGGCCGCCAACCGAGTTCTGGGTCGATACCTAGAACTCATGAAGGTGAAGAGCAACTG
GATGCGATCCTTCGCTCCAGAGGTTGTTCGCCAAGCCATCTGGATGGAGCTCGGTGGCGAGTTAACTGTGCCCGTGGAGTCGTGGAGTACTCGGCAGGTG
GCCGAGAGCACGGTGCAACTCCTACGCGCTATGGGATGTGAACCCCAAGGGTTCCCGTCGGAAGCAGACCTCCGAGCATGGGCACCCGAGGACGCCGCTA
CGGCGCTTCGCAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAGGCGGGAGTTAGCCGTCCACCGAACGTCCGCCACGCATCGGATCCGGT
CGACCCGTCCATGATTCCGTTGCCAACGACCCCTGGGAGACGCCCCAGAGGGTCGACCGAGGCCGGAATATTTTCAGCCCAAGGTGCGACGTCGACATAC
TTCCAAGACTCTCACATGGTGACGCCGAGGTCGGTCAGTCGCACAGAACGACTGGCGAGAGAGGCCGAGGGATATCGAACCGCTCCGACTGCTGGACGAA
GTGCGAATCGGACGCCCAGCCGACGTGACGACCTCCGCGATGACTCATCTGACGAAGATTCGTTCGACGTCGGAGACACCGGGGGTGACTTGACGGGAGA
ATGGGCACGCCAAATTCGTGAGCTGAGCGCGGTGGGGAATGACAGTGCGACACCGAGGCTAGAGATCGCTACGCATCTCCCACTCGGAAACATTAAGCCG
TACTTGGGACTCCGCGATAAGAGCGAGAAATCCATGCAGTGGCTCCGAGCGTTCATATACGAGATGAAAGGGACGCACACGCCGCCCAACGAATGGTGCA
TGGCGTTTGAATTGAGCCTCCAAGATGGTGCTCTCCATTGGTACCGACAGCTGCCCCGCAAAACGAGACGCACGTGGAAATTGTTGAGCGATGCGTTCAT
TAAATACTACTGCTCGAGGTTCAACCAGTCTGCGAAGGCTCGGTACTACTCGGCCAAGCGAGAGGAGAAGGAGCATGTCTGCGACTACCTCAACCGACTT
AACGGCTATGCTCGCAACGCCGGAGTGCAGTTCGAGCATGGCGGTCGTGATGCAAAGGACCACGTCGAGCATTTCTTGGATTCGTGTGAAGACCGAGGTC
TAGAAGAGCGTCTGTGCCATGTCCGAGTTAAGAACATTCACGACCTCGAGGATATGATCAATGATATCCTTCGTCGCAGAGAGCGAAAATCTGGACGCGA
GTCCTCGGTCCGCCGCCCTCGAGGGCAAGAGGTAGCACGCCGACGCGATGGTGGACGCTCCGAGGATCCGCGGGACGGCTATCGCCGAGACCGACGTCAC
CGAGAGGACGACCGTCGTCGAGAAGACCGTTACCGAGACGATAACCGCCGCCGGGATGACCAACAATATCGACCGAGGGTCACTCTCACTGACGCACTGA
CCAACATAGTGACAGCACTGAATGCGGGACGCTCGGTGGACGCGCGTGGAAGGTACCCAGAAGCGTACAACGACGGATATGATGACACCGAGGAGAATGG
GCCGGAGTCTCACTCTGGCGATGACGACCGATACTCCGAAGGGTACTCGGACGACGGATACGCGTCGACCGAGGACCGAGGCCACGTTGCTGCTGCAAAC
GACTCTGAACGTCGCAATGCGGCTGAAGGAGCGTTCGCTCGCGCCGACAACCGTCGGCCGAGGGCAAGTAATGGCCAACGCCCGTATGACCGAGACGACC
AGCGCCGAAACTCCACCGGACGCGATGGTCGACGCCAATATGGTCCATGCGCCGCCTGCGGAGGACTCACCCATTCGGCTCACTACTGCTTTAAGCGATG
CAAGATGTGCAAGCAGGTTCATGATGCCGGGAAGTGTGAAGCCTTCCAAGAACTCACGAATCTCCTCCGAGCTAAGGTCGAGAAGAAGGACCTCTCGCCA
GAATTGCAGGAACTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTCCCAATCGGGCTGCCACAGTTAGCCAAATCTGC
GCTGGATGCGGACTATATGTTCGCATTCGCAGGTGTGAGCAAACGGCCTGATGACTTGAATATGGAATATGTGAAAACGACGGAAAATGTAAAGGAGAGA
GGCATAAGCCTCGGTGAGAGTGAAGTGAATGGACGACGTGTGGACGGAGACGGAGTGGAGCTAACCGATGCTTCGATCCTCAGCATGGCCAAAATCGACC
ATCCATCCCGAGACCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAGAATGGGGTGGTGGTCATCCCAGCGCTATGACAAGAGGAAGCGATTGCGAGC
CCTCGTCAATGGGGCTGTAAACGACTCGCGAACGAGGATTCTGCTGGACACTGGAGCGAATGTCAGTGTGATTTCCGCGTCATACGCGAAACGGTTGCGC
TTGCGCGAAGTTCCAGACCACGGTAGGAGTCTGGAAGTGCGAGGAATTAACCCAGGGGTGATGGAGACCCGCAGACGAGCACTCGTTAAAGTCACGCTAG
GCTGGGAGCGCGTGTACGAATTTGAAGTATGGGTTATGGATCACAGTGCAGGAGTGGACGTGGTCCTGGGAACAGACTTCATGATTCCAGCCGGAGTCCG
GTTGGATCTGTTCCACGGTACGGCGAGACTACCGGACGAGGTAATGGTGCCCTTGGTGAAGTCGCCGAACTCAGCAGAGGCTGAGCCGTACAGCATGCAA
GTGACTGGACGCCCGACCGAAGATTTGTTGGTCCCAGGGCGTGAGTGGCGAGAATTTAGGTTACCACGACGACGGCCGCCTCTGACTACTCACGACGTGT
GGGCACGCCGGATTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACGAGGGCAGCCGAAGATGATGCGACTAACGAACGTGTCACCGAAGATTGCTCA
CTGCGCGAGACACGAATCGGTGCTGCTGTGGGTGAAAAAGGGTGACCTGCCGCAAGGGGATGGATACACTCGTTTGAACTCCGCCAAGTATGATGAGTGG
CAAGTCCTGGCGTACGCGGAGTGTCGAGACGAGACTTTGTTCGCGCGGGAACGCAAACTCTACGAACGGTGGTTGGCAGATCAGCCACCAGCTGTAGAAC
GACGAGACTATCCGACACCTAGCGGCATCCTACCTCGACCATCCGACGACTTGGAAGGCCTAGACGAGGGCCAGATAACGTTCGCGAATAGGGGCACTGA
GGAACCGGCAGAACGAGACCGAACACCGTTGACGACTTCGGTGCAACCCTCTGACGAACCTGTTGGAGATAGATGGGTCGACGTAGATGACGACTCGGTG
GCGACCGACACCTCTGATGGCGCGGATACAACGTATACGAGTGAAGAGAACTCCATCCCAGTCCTCGGTGATGACCCGGAGACCCGATTGGACTCTGCCT
TCGTAGCAATGATGCATGAGATTACCGCGGGGGACGGTTCAGGTAGTGGGAACACCGATACCAATACGTCCGAACATTTAGCGAATGAGATCGAGCTGAC
GGACTATGCACACGAGTTGGCGTTCTTACCGGACCTGACCGAAGCCTCGGAAACGGT