Description :
From Genome Similarity Track
Location :
Scaffold_1996:188- 3388
Sequence
3200 bases(100 bases per row)
GTCTCGTACATCCCCCATCAGGTACTTCTTTAGTCCCAGGATCCACACTTCCTCGTTCTGTGCTTTGAAGCTCCGCTCAATGCGGACTCTCTTCGCAAAT
GTTTCCTCGAGGATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGATCCAACCACCACCACTT
CGTCTAGTCGATTCAACGTAACGAGATTCTGATGCTCGACCCCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCCGC
ACTGGCATTCCAATCTCGCTTGACATGCACCAACCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATC
TCACCTCGTACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGT
TATACTCCGCTTCATTGAGGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAGTCTTCACAGTATTGCACTGTACGCCCC
GCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTAGGG
CTCTTTACTTAGGAGCGATTTTAGTTAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGA
ACACTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTGGAG
TGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTGTAATTGAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGT
TCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGGTGACAGATCCCTTCATGTTCTTGTACCAGAGCTGCTGAGACTGCCCAGTCACTGGC
ATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGTGTGGTCGCGATCCTGTTCCTCAGTTCCGGGAATGCGTGTTAAGCTCGG
ATCCACCGAGGTTCCGCCTTTTCCGAACTCTGGTCCGTCGTCTCTATCCTGATTGGATCCTCTTTCTTTTGGTCCCGGGGGGGGATCCAGCTCCTGTTTT
AGGTCCTCTTCTGGCGTCGTACTACTTGGATCCCTTCGTGGATCCGACATCTCCAGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGGAGTGGTCA
TCGCGGCAAAATCTACCTCTCTCAATTCGTACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGAATGTAGTAGTTCAAACTTCCCAAGAAGGA
TTGCATCGCCCGTAGCGACTGTGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTATGGGGTCCCAGGATCCCCTGGCTCTCCTGCTTCGAATGGATC
CACTTCCGTATGGCCTTCCCCAGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGT
GCGTTCTTCAATCCGAACGGCATCCAGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGATCGATCCGTCATAGTAACCACCC
AGAAACCACTGGCCATGTCTAGAGAACAGTATCAGAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGT
CAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAACT
GATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCG
CCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGAC
GATCCATTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCC
TTCTCCCAGATCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGACC
CTCTTTCACCTGGCAGTCCTTCTGGCTTCGGGGGATCAGGTACCCTGGTATCAGGAAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCC
CGACAGTCCGGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAAAGCTTGGATCCCCTTGTGGATCAGCGGGATCCGGC
TGTTCGGCTTTAGCCCTCCGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGAGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCATTG
CTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCAC
CTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGAGATCCCACTGACACATATCCAGGTCGCCTAGGG
ATACCGTCCTTCGCCAACCATCGTCCGATCTTCTCATAATGGTCCAGTAATAGTATCTTGTCGCTGACGTTCGTGACCTGGAGGTATCGTGATCGACCTG
GTCTCTGGATTACGGTCGGCACCCATTTCTCGCTCCGAGTGACCCACAGTTTCTCATGTTCCACCCACCTTAACCGATCTGGCAGTTCCCAGGTTTCCCC
GGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTAAGCTGGATCCGCATCTCGTCAGGGAAA