Description :
From Genome Similarity Track
Location :
Scaffold_3192:188- 2413
Sequence
2225 bases(100 bases per row)
GTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATATAGTACCGCAGCAAACAGCGCGTCATTCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCA
AGAAGGATTGCATCGCCCGTAGCGACTGTGGGAAGGACAAGTCTGCTAACGAAGACAGGTCTTTAGGATTCGCCTCCAACCCCTCCTTGGAGACTCGATG
GCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTAATAGAGAGATTCCACTTAGTACACGCCTCCAGTAAGGACGTCACTCTCTCG
CACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCCCCCGCTT
CGAATGGATCCACTTCCGTATGGCCTTCCCCGGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATTAGGCGTTGGTA
GATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATA
ATAACTACCCAAAAACCGCTGTCCATGTCAAGAGAGCAGTACCAGAGTACTTTATTCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCA
TCAATCGAGTCAGACCGTTAACCAGCCGGTAATCTATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGCGACGCCCACGGGGA
CGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTACGCACCCTCTGAGCGATC
AGTTTCGCGTCGCCGACATCGATGTCACATTCGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTTTTCCAGATCT
TCTGACATAACCGATTCACTTCCGCCGGCTCGTTCGCCCCTGGATCCGCTTGGATATCGTCAATCGTGACCTCCTCTGTGGTGATCAGTGGTACCTCCGG
GATCACCGCCATGCCTTCTTCCAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGA
TCCAAACACCGCGACCCTCTTTCGCCTGGCCGTCCTTCTATCTTCGGGGGTTCAGGTACCCTGGTATCAGGAAAACCACCAGTTGGATCCAGTTGGTCCT
CTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTAATCCAATGGAGAGCTTGGATCCACTTGTGG
ATCAGCGGGATCCGGCTGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCGTCGTGG
ATCCAACCTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGCTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTG
ACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGGGTGACCCACAGTTTCTCATATTCCACCC
ACTTTAACCGATCTGGCAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCG
TCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCAGCCAGATCCAACCTCACTCCGGCTGGCACCATGAAATCCATCCCAAGGATG
GCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTAATTCGCGTTCTCCCGTTCGTACGGTATA
CGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACC
ACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGG
GACTCCCCTGTTAGCAGATCCATGG