Description :
From Genome Similarity Track
Location :
Scaffold_3434:188- 2269
Sequence
2081 bases(100 bases per row)
TTAAAGGGGCGCGTTCTATTAGCAATAAAACGGACAATTTACCGTTAAAAGTCGTAAAGTTATGAGTTTCTTATGATAACATAAACGAAAACGGCGAACA
AGTTGGTGGCAGTCAAAGATCTATTACGTCTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCT
CATAGTATTCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGTAGAAAGGTCGCGTACTATGGATCCAGTGTCGTCACCGAGGATCAGCCA
AGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGATACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTG
GAAGCGCGGGCGAGGATCCGAGGACAGGAAGCCCCTGTGAACGCGAAGGCTCAGGACCCAGTACGCCCTACGCGTGATCTGACACAATCCAGCCAGGATC
GAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGGCTCGAGGTAATCGCCTCACGGACCCTGTCTCGCCAGTGGACCAGACGGCCACAGG
CTCTTCCGACACTTCCTCGGGCACCCTGCAGCGGCACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTG
CAAGTGCTTCACGAACATGGAGCACGAGACGTGGAGATGGAGTCAGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCAT
CCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTGAAGGAGTT
CACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAACTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTG
ACCTTTGCGGATCTGCTAGCGGGTCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGCAATTTTCCAG
ACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTGGAATACCTACATCGACTAAATG
TGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACATGTGGATCACTTCATCGAGACGTTGGGAGATGTGGATCT
GGCCGACAGGCTGACCTGTTACGACTTCCCCAGCACAGACGAGCTGAGGAGATGTTGCGGGCGTGATATCGCGGAAAAACACGCCAGAGAGAGAGGCGGG
CGTGAGTTCGGGCCAGATTGCGCACAAAGGGCCCGAGCGCCCCACAGCCCCCATCTGGAGCGTTCCACCCAGTTTAGCGGGCCCTGGACTCGAGAAAATG
AATTCAGATTCCGACGGCTCGGACTCCGACCTGAAGATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACAGGAGACAACTCTCG
ACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAG
CACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCACTGCTTCTACGTGTGTCGCGGGTGGGGCG
AGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATACAGCCAAGCACAGAGGGATGTTGCCAGATGTGGC
CGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCGGGTACGAGCCGAGCGTTTCTAGGCTATTGCATATATACATTGGTGAACAAGACATCGCT
AGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTT