Description :
From Genome Similarity Track
Location :
Scaffold_506:18799- 23812
Transcript NameFunction/comments
Phypl_g8982hypothetical protein
Phypl_g8983hypothetical protein

Sequence
5013 bases(100 bases per row)
GTTGGGCATGCCGCATCCGCCACCAGGAGCGGGGACCCCGTTGGTGAGTCAAATTGGCTATCAACATCAGTATCCTCTTCGTCAGAGAGATCCATATCCA
AAACTTGGTTGTCCGAGTCCGTTGGCGAATTTGCTCCTTCCAGCCCGGTAACTTCCGGGTCTCGACTCTTCTGGTTGGCATCTGAAACTGGAGCTATCAC
CACTGATGATGCCCACCCCggggcagctgcagcagcttctagCGAGACAACACGCATACGCAACCGAGCGGCATGCTCTTCCATAGCGTCCATTTCGTCT
CGACTTGCGGACGCCaacgcctccagctgctggcgtaAAACCTGATTCTCGTGAGCAAGCTCCATTAgcgcacgagcacgttgatCCACGACTTCGTTAA
CACCTGCATTCACCTTGATCCGCTTGGCGCGGCTGGCAAACTTGAGCGTGCTACGAGTGTCCTCGATGTAAGTAGGCGCCGGAGACGCACAACAGACAAA
AAGCACACGTGCCGCACCGCTTAGCGACGGTTGCAAGATGCGCGTGAGCTTGCTGTCGCGGAAGTTGACGTGATCGTGCTGGTTagacttgctgctgccg
agcgccaccacAACTCTCGAGAGTGCCAACAGACTTCTGTTAATGTTTCCGCTCTCTGTCGTGAGTCTCTTGCCCCCCGAGCTGACAGCCCGCGCGCTTT
CAGATCCCGCCAAGTCCACGAAGTTCAGGCATCCCACACGCACGCGCCCGGCACCGGCATCGTCCTCAGTCGGCACGGGTGACTCCAGCCTCGTCTTGGA
TTCAATGACCACTCTGAAAATCGAGTgcgagcgactgctgcgtTCGTTCATGCGGGTAACCCCCACcgctcgctgcttctcgccaTCACGCAGTGCCTGC
AGCACTCCACGTGCATCGGTCACCACCCGCTCCGAGTTGTCCGTAAACACTCCGGTGACGGGGTGTTCGCGAATATGCACACTGGAGTCTCTCCTCTTGC
CCGTCGCCGTGGATCCGCCGCTCACCAGCAAGTCCTTGACCGTCTCATTGTACACTTCCAAGTACGAGACGCGTACCAAATACTCCACATCTGAGCGTCT
CGCCATCTCATCGAACAAATCCTTCACCGCCAACTGCACCAGTCCGTCGCTGTCTTCGGGTCGTctgtcctcctccgtctccactctcttctcctcgtgc
accagcgtccgcctcctcctcacACCCGTTCCCTGcatcgtgtacgtcttgccgctgctcgtctgTCCGTACGCGAAGATGGACCCATGGatgccgtcca
gcgccgagcggGCGATGGACCGCGCCAGTCCGTCGTAGATGGCTCCAGTCGAGTGCTGTGCGTCATACACCTCGTCAAAGGCGTAGACCCCCCGACGTCG
AGCGTTCTGCCCCAAGACGGGGGCCGCCTCCACGGTGCCCGTCTCGGTGTGTACAGTCCACGCGGAccgactgctgctcttctccttgggCACGAGAGGC
CGGAACCGAACCGTGACGCGCACCGTCTCGCGTCCgtccgcgtgctgctgctgctggagaagctggaggtcgtccacgtccagcagttCGGACccgtcgc
agtcgctgggGGCGATGCTCGAGGCCCGTTCCGACCAACGCACGTCGCTCTCGAAGCTCCcgctgcgactgcgactggAGCATTGgctgtagctgtagct
gAGACGCGAGGCCCGCGGCGGACgcaccagcgacagcaggtCGCTGTCCCGACGCCGCATCACTGGGGGGCGACGCACGTCTCAGTAGTTTGACACGTTA
GAAGCACGGACACTAATGGGGGCGGAAGTAATTTGGCAAGTCCGACGTAGCGTAGTGATAATGATACGGAAGGCGTATGGCGTATGGAGCTCTCTGATTG
TCCTGTTTGTTCGAGCCAGAGGGAGCGATACCACGACATGCGGTCGGATAGGTAATGTACAAGTAGGTTGATGAATGGTACAAGAATGGGGCATTTATGC
TGGATAATATACGGGGAATGTTGCGATAAAATAGGTTTGTATTGTGCTTGTCCAGTTTACGTTGTAGTAATACACGTTAGTGATTGATCTTCAACACGAT
CTCGGAGTCTGGTGTGTGCTGTCGGTTGTGTCGCGCGTGGACGAATTCTCGCCCCAGAAGTGCGGCAGGAACCGCAGTCGTTCGCCAAGTCGTTCCACGC
GAGAGTTGAAGCGGTCTCCGATCCGCGTGGAAACCACCTCGTGCATTTGCAGTGAAATGCCCCATTCCGGCTGTTCAAACGTTTTCAGGAACGGTTGCAC
TTTGAACTTCTCCTCGACAATTCCGCCAGCGCTTGAcgacgtctgcagcagttcgtccTTGTAAACAGCGAGGGCCGATTCGCTCATGACGATCTGTCCG
CCTTGGCCCATCTCGCTCATCTCGCGCGCCGTCATTTCGCTGAGCCCCAGGTAGGTCATCTTGCCCGTGGTCGGGTGTCTTGAGCACACCAAccgctcgt
cgccgtcgtggacggccATGCGCACCCGAAGGCCGTTGAAAAGCAGTCGCGTCCAGATATCGTACACTCGCGCTGCGTTGTCGTATTTGAGCAGCGCTGT
CGGCCACGGAGCCTTCAGCAACTTCTCTTGTACGCTGACGCACCACCCGATGGCGTCCCGGACACAATGGAACGCTAGCTGAAAGGAATCGCCCGCGGTC
GTGATCTCGTAGCCTCGGAAGCGAGGCAGTTGTTGACGCAGCAAGTCGTCGTGGGTCGACTGCGCTTCGGCCATCGCCTGCGGGCTGCCGGACCAAAGTT
GACTGGAACCTTCAATGTCGGTGACCACGAAAATCGGTCGTCGGGTAGGTGCCTCCACGATGACGTCCATGGTGTCTAGACCCAGTTCGTCTTGGAAGTA
GCCACCTTCCAGAAGTTGTTCATACACAGAGGGTGGCATGAGAGGGCGTAGAGCTTGGTAGCAGCAAGTGGCGCTGATGCCGATGGCGAATGCTGTGCCT
GCGCCCGACAGGTAGTACAGGATCTGCGTGAGGCCGACCCACTCCATCTTGAGGTCGTCGATAAGACGGGCGGATACTTCCACTACACAGGACGGGAACA
CCAGCACACAGTACACAATGACAAACATCTTGATGCGCTGGTGAAGCAAGAGCGATGCTGGATCCACCGCACTTCGAGTGCGCTTCTGACGTGAGATCCA
GATTGTGGCGTACAACGGGTACAGCACAGACACCCAAATGCAGCCCAATTCAAACCAAAAGGCAGCCGTTTGCAGCgtcttggacttggcggACGGCAGG
AAGGTGGATACAGCCATCAAAATGGCAAAAATCACGGCCACGAGGTACGCTCGAAAGCAGTACTGGCGAATAATGGCACGCTCGCGCTTGGGTCCGCGGT
CCATGGACTTGATGATGAGGCGCTTCATCTCGTACGCCAGCGTCGTGATGAAAAATGTCGTACACAGCAAAGCACAGTCTCCGATGAGAGTGACGGTGAC
GGCGATCGCCTTGAACTCCTTCCCGTCGGAATAGACTGCGCGCGCGCCCATgagctcgccatcgtccagCGCATCGAGAGTGTCCCGCAGCCCGTTGAAA
TTGGTGAGCACGCCCACGTAGAGCAACAGCCGTGCGAGCGAGTAGACGAAGTACAGGCGGCACACCGAGTAGGTGATGTACTGCACGGCCGAGTCGCCCA
CCTTGATGTGTTTGAacgagaacagcagcgtcgagcccgtcgcggccgtggccaccgccagcacgaTCACATACGTCAGAGTCCAGTTGTAGTGGGTCGA
ATCATCCATTCACGATCCGAGATCAAGTCGCCACGCAGGACGCGTTCGCTGAAGGCAGCAGGTCGTGTCACCAACACTGCAACACTGCTCGAAGACGGCA
CGAAAAATGAACGCGTCGCTCAAGTGCTTCCAGTTAATAATTCACGCTGGTTGCCAATCAAGGAATAGCGGAGACTTTCACCATCGCCAATTGAGCTCCG
AGCTGGCTGTGAGTTTGCGCAGCAGATGGCCAGCCCTATCCAGCGTTGCCTCGAAGCTCAAACCCAAGTCACAATGTGCTGTGAACACCTGGTGCCTCCG
TAGGCTCCGTATCGTTACTCGCGACACCGGACTCCGGTGACCGGAGCCCATTACCTGCCAGGTATGACATGTATTACAGTGTACCAACCGGTAATACCTG
GTACAGTCTGTACTGGGCCGTGAAAACAGAAAACGGCAAAGCCTCGTCTCGTTCTATGCGGTCGGGTCTCTGGGCAGCATGAAAGGAAGAGTGCAAAGTT
GCACGGCGACAATGGATCGACGGCACACTCGAACGCCTTGGTGGATGAACTTCGACCTTGAGCCTCAAGTTGCGCAATATTTATAGTGGTAGGGCAGGCT
GTTTATGCCGAAGGAGAAAAAGTTGCGTGTTACTCCACATCACGTTGGAGGAACTTTTTCAACACACACGCATTGCGGCGGTCCTGCAACAACCACTCGA
GGTTGAACGCCGCAGTACGTTGGGTTCGTTTTGCTCGCTGCTTGAATTCTTCCTGCTCAACATGTACGGCGTTCAATAGTTTCTGCCAATCTGCCCCTTG
GCATTGTCGCTTTTGTTGAGCCCCTTTCGATGACATGACTTGGTCTCGCTTGGCTTGGATCGTGAACTCGAACGCACAAAGTCCTATCGCCCAGACCTAC
GATAGAGTGCACAGATTGATGTCCAAGTTAGTCGTCCATATAATTGCCTTGTGGTGTTGGGCGTACCTGGTGCTTCTGTGCTTCAAACTTGAGCTTAGAC
GACCGATTCCGACCCTGAGCCGAAACTTCCGTAGCTTTGGAAGCTGCGTCGGATCCTGATCCTAGCTCCAGGCTGCGGTGAATGCCCTTGGTCATCTTCT
TCAAAATTCGACAGATGCATTCGTGAAAGAAGTGCATGTCACGGTTCACAAACGGCAGCATCTTGATGAGAATCGTGAATCGGTGCGCTGCCACGATTAG
CATCTGGAACAGA