Description :
From Genome Similarity Track
Location :
Scaffold_3:187963- 189126
Sequence
1163 bases(100 bases per row)
TTGTATGGATGGTGATGTGCGAAATATTTCCCACGCAATGGTGTGGTGGCCGCCATGAACCACGCGCGATGGAATGGGTTGACTTCAACGCGACGTGTGG
CTTGCGCTGTCGCCGTCGGAGAAGCACCACCGTGACGGTCATCAAGCTAAGAGCACTCGGAAAAGGCGTCGAGTGGCTGTAAACAGACTGTCGGTAACCG
TAGACGTCGGGCGTTCACTCGGGCCCGTGCATCCCAGTTACTCGCGGCTTCGATCTTGCACACTCGTTCGGCCGTCGTGTGCAATTGTATCGAGTTTACA
TCATTGTGAGGCCACTGGGTGATGGCGACTCGTTACTTCGCTCTGAGTTTCGGCCCGCATAGCCGTCGTCGTCGTCGTGCTATAGGTATCACGCTGACGA
GGTATGCGCGTCGCATGCTGAGTGGCCCTTCTCTGCGCAACGAGTCCGTACGATGCTGCATCAACACTGTGTTGGAAGAGTTGTTCTCGTTGGGTTTTCG
GGTGTATTAGCTTTGGAGACTCCGTCGTTTCGAGAACGACGACGATGCACCACCACCACGACTCTCGGGCTGGAGAAGGACCCGACGCAATCAGTGCACA
GACGCACGGTTCGTGTCTTTCGAGCCGTAGACAAGGCGGTGATGCGCTATCGATTCTACGTATACAGCCCCGTGGCCACGTATGCGGGCGGTCGCTTTCG
ATAGCATTCTTTTTTGCTGCACACGCGAGACGGGTTGGGTGGGGGGAAGGTTTTGGGACATTCCTCTTATTAGTTCAACGCACGGTATACCCAGACTCAC
GTCGAGAGGGACAAGCACCAAACTGGTAGAGCTGCCGGTTGCAGTAGTTGGTGTGTCGCGCTGTTGTGCCATCTCTTGACGCGTCGCTGGCCACTCTCCG
CGACGACCATTGGTGTGCACGCTACCTGGCCCCTCGCACAATAATCTCGCTCACGACCACTAACGCTCCTCGCTGACGCACCGGCCACGCCTCACGAGCG
CATTAGGAAGTCCACCATGTCTTTCTAATTGCATGTAATATAACTCAGTTCAACAACTACTGGCGATTGCAGTACAATTTTTTTCGAAAATTGATTTGGC
GCGCCACTGAATTGTATACTAGTACCATAAATGAACGTGTTTCGCGTTATCGTCGTTGTTACA