Description :
From Genome Similarity Track
Location :
Scaffold_367:18790- 24014
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_367-fgenesh-gene-0.16U6 snRNA-associated Sm
Pytul_var.sporangiiferummaker-pug3_contig_367-snap-gene-0.24COMM domain containing 2
Pytul_var.sporangiiferummaker-pug3_contig_367-fgenesh-gene-0.17Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_367-fgenesh-gene-0.10Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C
Pytul_var.sporangiiferummaker-pug3_contig_367-fgenesh-gene-0.18Phosducin
Pytul_var.sporangiiferummaker-pug3_contig_367-snap-gene-0.26WD domain, G-beta repeat containing protein

Sequence
5224 bases(100 bases per row)
CGCGCTTACTCTTCCTGCTGCAGGAACGGGTTCGGGATCTCTTCGGTGCCGTCCACGGGCGAGATGAGCATCACGGACGTGCCTCGGCACACGACNNNNN
NNNNNNNNNNNCGACGTTGCGGGTCTCTTCCGTCAGTCGGTACTCGTCGTTCGGGTCGCGCAGGAACTCGACGCAGTCGTCCAGCACGAGGTTCACGAGC
TGGTCGTAGCCCTTGAGGAAACCGTGCACCTCGCGGCCACCGTGGAACTTGACGCGCACGGGCTGGTCGATGTACTTGCCCAGGTCCAGGATTGGGTCCT
TGCGTGACGCGGAGCTGCCACCGCTGCTCGACGTGCCGTTCGCTGCCATCTTGTGTCTCTGTTGGTAAATATGCGTTTGAAAGGGGGAGGTTCTTGGTCA
AAAATGGTCTGTTTCTCAATATCGCACACTATTGGTTTAAATAGAATCAAATATGAAAAGTAGTATACGTGATTGGTGTAAATTGAGCCAAGGTGAGAAT
TGCTGTGGCAATGGATCCATTCTGGCAAAAGCTACGGAAGAATGAGTCGAAGCATGACGTGGGATGAGCGCGTTCTCGACGCCGTGGTGCGCGCCAAGGC
GATCTCCATCGAGCGTAAGTGTCGTATACGCTAATGCGATGAAAGTGCTGAATATTCTCTGTGTGTGCTGACACTGCTTGGGTATTTTTCGATGAAGAGT
TCGACGCGGTCTGCAACATGGCGGTGCTGCTGTTCCACGCTGACAAACGGCAAAGCAAAAAGCGTTTGTCGCGCACGGCCTGTACGTGTAAATGTCGGTG
TATTTACATGTAGGAATAATCAGCCATTGATGTGTGTGCATGTTGGTGTCTTTTTCACAGCGGCGTGTGGATGGGACGACCCGATCGCGGAGGATACAGT
GCTCGCATTTGCCAAGATCTTGATGGATTCGGCCATGGTGAGGCGCTTGCTTCCTGCTTAATTACACCGGTCTTCTACTGCTAATTATTTGCTGTAAATA
TGTCTTTTTGTGTCCATGTCATAGGCAGATCTGTCGGAATATCACTTCCAGGTGTCAATGAAGGCGATGGATCTTCCAGCGGCACATGCCGAAACGCTTA
CAAAGGTGCAGCAGTACTTTGCTTCTCTCCGTCATTCTTCCCACAATGAACCATGCCGTAACATGTATGTGCATGTGTGGCTTCTTGCAGCTGTACTTGG
ACAACTTGGACACAATCAAAGAAAGCGTGTGTCGCGAGACGGGCACGACCCTGCCACGCTACCAGAGTCTCGACTGGCGCATCGACTTGGAGGTACGATA
GGATCGCTTTGTCTGTACTACTTTGGCGTCGCCGTAAAATGTTAAAAAATGAGAGCATTTTCTAATCTGGTGATTCACGTAGGTTGGCTCTCGATTCATG
AGAAACAAACCCAAGCCCTTCGTGACACTGCGCCTCGACACCATGAAGCAAAAGGCCGACGATTTGCCACAGCGCCAGTCATCCTGCGTGCGCGTCGATT
ACGAGAATCTGCGTAACCTGCAACGCCAATTGGAAGCTGCGCTCCACGAAGTTGACGCGACGCACGCGTCTCGGATACAACGATACCTCCATTAGCTGTC
ATCTGCACTCGCAATGTCAGCGCAAAGAAGAACAAAAAAGGAAACGCAGAAGCCACGAATCAAATACGTCACAACCATTGATAACAGCCGTAGCGTGTGC
GTGCGCTGTATATATAAAGTAGGTGGTGATGAAGTTAGTTTCTAGCGCCTGGGTGCTTGGGGGTGAAATCGGTCACTTGGTCCAACTGCTTTTGCGTTTC
CTCAGACGTCGCGTGCTTTGGCATGAGCAGCTCCGCGAACTTTGCTTGGTGCTTACGTCGGCGCTCCAGATCCGGCTTCATTTTCGTTTCCTATACATAA
TATAGTATAAGCACACATACACACAAAGGCAACCATTGGAAACGCGCAACAGCATGATGCGTTTTGAAATGATTTGCACAGGGCGGCAGCAGACAGCGAG
CCAACACACACGCACCACATCTTTGCGGATCTCGTCATCGGACTTGGGGTCCCAGAAGTAGTACGCCCCCGCGATTGGGACGGAAAACAGCAGCGTGTAG
TGCAGCAGCATCTTGGAGACCTTCACCATGGCTCTCAACGGCGCGTTCTGTTCCAGAGTGCACTCGTTAGGATGAAATGGTAGTGTTTTAAGTACGCACG
CACTTGGCGGAAACGAACTTTGTCGTTTCGTGCAATACGAACCTAAACGTTAAGTACGCTAATCGTAAAGTTAAGGGTCTCAATGCGTACTTAGTATACG
TTTTGCAGCGTTGGAGCTTGTCAGTGGCGAAGATGATGGCTTGTGGAATGCAACGAGTGCTGCGCGCCGCAGTCGCAAGTCGCCGCTGTGCATTGCGCTT
CAGCACCGCCAGCGCACTACCAGAAGGACTTCAGGAGATTACGCGGGTGCGTTGACGCTTGTGCTCTGCAGTGATACGCTTTCTCCGTTCTTCTAGAGCT
TGGATGACAGTGAATTAGGCGCATTTTGCATGCGAAAATGACTCAGACTAACGAACGCTGCTACGTGAACTTTAATACCTCCTTATTACCTTCTGCTGCT
CACCATTAGATTCCAAGGAATCCTTCGTGGTCGCTGACGGAATTGCATCATGAAGGCGACGTGAGCGAATCCGAGAGCGTGCTCACTGAAGCAAAGGCAT
GCAACAAATCGCTCGCTGGACTTGTTAGTAGTAGACTCACGTATTGCATCTTGGCTTTAAATCATTTTGTTAAAATGTAGCTGCGGGAGTTGGCGGAGCT
TTGCCACTTGCACATCGACGATGCCAAGCTGCCGTCGCTGCTGAAGGACGTCGAGTCGATTATCCAGTGCACCAAGACCATCCAGGCGATGACGCTGAAC
GAGAACATCGACGACCTCTACGCCAAGGACGACTTTGACTCAGGTGCGCGGTTATGAACTCCTGTATGCTACGGATGTGGAGAATATGTGAATGCTAATT
GTTTTGCAATGTTTATCGTGTGTGGTGTATGTGATTGTTAGGCATCGCGCCATTGCGCGAAGATGTCGTGACAGAAGGCAATTGCGCGGACAAGGTGCTC
GCGAATGCGGCCGAGAAGTCGGGCTATTTCTTCAAAGTGCCCAAGGTTCTCCAAGATTAAACAAACACGATGCAAGCTCACGCTTACAGCAACAATCCAG
TATATACAAAAAAAAATCTATTTGGAGTGACAAAATGATAGACTACGCGCCTAAGCAGTGCGTTTAGTTAATCTGCCTTAAAGACTCCCGCTTCCGCGAG
ACGCTCTTCCAAATCTTCGACCTTCATATCCAAACCACCGAGCTTGCGGATGCCCAACACCTGGTTCTTCAGGTCGCCCTTGTGGTACATGAACAGCGTC
GGACAGTTGCTGTAATAGCGATGCAATGGGGGTCAACAAACGCATGCACAAGTCAGTTTATATACAAATGCCACAACATTATCATTAAACACCACATACC
GCTGTGGCCAGTTCTCGATGCACGCCTGCGCCTGGATGCTCACGAACTTCACGTCGCGGTGGTTCTTCGCGACCGCACGCAGCACATTGTCCATTAGCTT
GCATTCTTCAAGCGCATCATCCCACAAGTACGCGATGACCCAGTTCTCCTGGCTGCCTTCGGTCACTTCACGGGTCCATTCGTCCTTTGAGATCGGCTGA
ATCTCGCCAAACTTGTTGCGCGCCATCTGCGCTTTCATCTCCGCAATACGACGCTCGCTGATATCATGTACACGCATAAGGGTGCAAATACATAAGGCGA
TGCGTCGTTATCATCGCGACATCATTTTCATAACTTACCGGATACGCAGCAGCTCCGAATCGTCGTCATATTCATCCTGTTCTCAACCACAAACGCATCA
AGACAGAAGCAAAGCATGCGCGTAAACATCACATCTTCCATGCACATCTCTTCCCTCAACTAGTCATATCGACTGCGTCGCATTCATATAGAGGGAGAAT
TGCACCCAATATAACAGCATCGTACCTCCATTTCGTCCAACTCGTCGATCGTGGCATCCTGGCGCGCGTCGTACTGCTCGTCCTCGGATTCTTCCTCCTC
CTCCTGCACCTTGGTCTTCGGCGCGAGGATGCCCTTCTTGATGAGGATGTCCTCCCACTCGGTCGTCTCGCCCGTGGGCTCGTAGAACTTGCTGCCGCGG
TCCATCGTAGCTGTTGCTGCTTCCTTCCTTCTTCTTGTCGATATAGAGAATGTGGCAATGGGTCGACCGAACTAGGTCACTCTGCAAAAAAAACTCATAA
ACTATGGCTAGTAACGTAATAAAGCGGAACTACCCATGAGAAAAATGTAGATACCGAGTGCTGATTCGCTAAAAAATGCAATAGGCCACTTTAATTGGCA
GTTAATCATTTTTTGTGAAACTTTGTGGTGCACACTATAGTAGGAGACCCTTAAGGCAAGTTACGCGCCAAAAATGGCTNNNNNNNNNNNNNNNNNNNNN
NNNNCATAATGAAGTGGAAAAAGCTCAAATAGATAGGCGTGAAAGCGCGATTTGCACGGCGCGNNNNNNNNNNGCTTCAAGGGCCAATAGCCATGGAGAC
CATGAAGGAGATCACGGTCAACATCAACGGCATGGGGAGCATGGCGCTCTTCCAAAGCAAGCAGCCGCTCAGCGACGCGTCTCCTGCGGGCCACGACATC
GTCGTCACCACGGGCGAGGATGGCGTCGTGTACGTGACGGACTTGAACCGCGAAGCCGCGCTCTTTGAGAGCGTGATCTGCGACGGCGCGATCCCGTCCT
GCGCCGTGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCGTGCAGGAAGAAGAGAGTGCAGTGTACAGCTACAAGATGCCGTCGGGCGGC
GTGGCCGACATGGACAAGCTGCTCTTCCGCTCGACGGTCGCGATTCGCCAGGTGGTGTGTTCGCAGAAGTACATCGCGATCGCCGACGAAGACTCGACGG
TTAAGGTATTGCTGCGGTCCGCGACAGACCAGGTGATTACGATTGAGGGCCATGAGCATGGCATCAAGAGCGTGGCCATTGATCCAACCGAAAAATACAT
TTGCTCGTCGAGCGAGGACGGCACGGTGCGCGTGTTTGAACTCAAGCCAGAGGCGATGGTCGCGGAGCAGCAAGCGCTCTTCAAGGTGCAGTACAAAGAT
AAAATGAAGGACGACGAAGTCGTG