Description :
From Genome Similarity Track
Location :
Scaffold_7:187864- 188969
Transcript NameFunction/comments
Phyci_90008Hypothetical protein

Sequence
1105 bases(100 bases per row)
GCGGCCGCCGCTGCAGCGTCAAGGGCTGCCAGAAGGGCGTCGTGCGGCAGGACCTGTGCACCGCCCACGGCGGCAAGCGCAAGTGCCGCGTGCCCGACTG
CACCAAGCACGTCAAGAAGAAAGGCCTGTGCCGCTCGCACGCCAACTCCATGTACGCTATTCCGACCCCGGGCTCGAGTTAAGTAAGTTGGGACGCGAGA
ACGCAGCGCCCTCGAGCCGCGAGCCCACCGAGCTCATCATCAGGTTCATCTCTCCCTGTCCACATTAAACACCACGTGTACATATAGGCGGATGCCACAG
TGTCTATACTGTTCCCAGCGGTCTCTCTCGGTCTCTCGGTCTCCCTCCTTTCGTGCTCAGCATGGTCGTCTCCGAGCAGGAGCGAGGGAGCATTGAACTT
TGAGCGCTGCCTCGGTGGTCGACTCGACCAGGGCGAGATCCAAGCAAATCCCATGTGGTGCTCGACGTGAGTCATGTCGATGTCGGACGTGTCAAATGCA
TCGGCATCTGTTGCTTTCGGTGAATCGATAGCCGCACCGAAAGGCAGCACCACGGCAGCGACCAAGGATGCTGTATGTGAGCAGCCTACATGCTGCCATG
CCGCCAGCATCGCATTGCAATATATCGTAGCGAGACGCCGCATCCGGGTTTGGGTGCCTGCGAATCGCAGTGCGATTGCCGGCCGCCGACACCTTCAAGC
TGCCGATCCACCCTGGTCTCGGATGCCGCCCCAAAGAACCTACACAACCAGACGAGTCATGCAAGAACTCGCCACGGATGCGCATTGCCAACATTGTCAA
CGCCAAACTGACGGGAATGGCGTGCTGAGGTCCAGCCGCAACCAACGAGCCACCCGGCGAATTCGCGCTTCCTGCTGAGTTCATCGTGATTCATTCATCG
GACTAGAGTTCGCGAATCGTGAACTCTAGTCCGATGAATGTTGAAGCCCGTGCAGGCAGCATCGTTGCAGTTCCCCGGGACCGGATTCTGCCGAGGCGGA
GCCGGTTGCAGCAACGTGCTGGAACCGTGCTGCTCATTTGGGCAGACCTCTGCGCGGCCCGGGATCAGCAGGGCCTTGAAGAATGGCCGCAATCTTGTGA
AGGTC