Description :
From Genome Similarity Track
Location :
Scaffold_85:18785- 52844
Transcript NameFunction/comments
Phyta_totarag3229transient receptor potential Ca2 channel (TRP-CC) family protein
Phyta_totarag3230hypothetical protein PHYSODRAFT_566381
Phyta_totarag3231hypothetical protein PHYSODRAFT_533462
Phyta_totarag3232hypothetical protein PHYSODRAFT_289190
Phyta_totarag3233conserved hypothetical protein
Phyta_totarag3234conserved hypothetical protein
Phyta_totarag3235conserved hypothetical protein
Phyta_totarag3236hypothetical protein
Phyta_totarag3237conserved hypothetical protein
Phyta_totarag3238hypothetical protein PHYSODRAFT_307593
Phyta_totarag3239hypothetical protein
Phyta_totarag3240conserved hypothetical protein
Phyta_totarag3241hypothetical protein PHYSODRAFT_342104

Sequence
34059 bases(100 bases per row)
TCAACCAACGCTGGCGCGTGGCTGTTGTGATTGGCTGCCTCCGTTAAAAATGTTCGAGTTCTGCAACAgccgacgagctgcagcttgtgcaaCTGGACTC
GACAACAACgaaacaccagcaccactcGGACGAGTATCCTCGCTGTCACCTGTGCGCAAGTCGTGCAATAGTTCACCGAATCCACGCCCATAGCTTATGT
CGCTTGAAAAGATGTACGCTCGGCCCTCTCGCTCGAAAAGTCTGCCCAAGGTAGAATCCACGCCTCGGGGTCGCTTGGAAAAATAAATCGGCACAATCGT
TTTCCCTTTGTCTTCAGCGAACGCCAACTGGTCACTAACCAACTCTGTCTTCACACTACGCTCCGACAGCACAACGAGAAACACTGAGCTCTGTAGGATT
GCGTCCTTTGCCGCCAAAATACGCTCCTTGGTGCTGGATACGTTCGTCATGGAATCAACCACGAACGGGAACTGGTGACGCCGAAGCTCTGTGCACAAAC
GCGTCACGAAGTCGCGGTGGCAGTCGCCGTGCGAAACAAAGATCGAGAACGTCGGTCCTCCTCCAAACGTATTCCTCCTTCCACTACCGCGCACGATTAC
AGCGTTCACAATCTCATCCATCCGTCGGCGTCTCAGAGTGGCAGCCCTACCCAAAGGTTGGTGTTTACTTACCGTCAATCGAGCCGGATCGCGATCGCCT
TCGAGCCGATGCATCTCCACTTCGTCTCGTAAACCGTCGATAAGGCTTCTGAGGCTAGCCTGGAATTTATCCTCATCGATCTCAAACTCGACGTGGTCCA
CGGTTGACGAGTCTGATGAAGTGGAACCATCGTCGCTGGAATCTGCCGTCTTTGAATGATGCGAGGTCACAGCCTGGCCGAACGGTACGATCTGCCGCGT
GAAAACGAACACTTGTAATTCCTCAGACAGTTTAACAGATTCACACGAAATCGGCACCACAGGAACCTCGTGTTGTTTGGCAAAGGCGAGTTCGTCCATA
CACAATATACTCTGCGCGTACCCGTCGCTGAGCATGCAGACGATTGCAGAAGCATTCTTCATCACCGCCAACGATTTTTCTGATGCACCACTTCCCTCTC
TGCCCACTGCATCTTTCTGGTCGGTGCGCATGTACACAGTCATAAAATTTTGCTCAATGCCGCAACGCACGCGTTCGGCGAACGCGCGAAACACTGGATC
AAAGGAGAGCACAACGTCGACACAACCACCTGCTACTTTAACTGCGTATTGAAGCTCAGCCGATGCGCAGCACTCAACGGCACGACGCCCCTCTCCGTTG
AGCGCGTACAGATCAGCCTTACCTTCGACAAGCAAGGCCAACGCAGTATCTTTGTATCCCAGTCGCAACGCGATGTGGAGAGGGGTCTCCTCTATCTCAT
TGAGAACTGTTGCATTGATATCCGCCCCAAAACGGACAAAGAGTTCCACACAATCATCTCGCAGAAGACCACCATCCACCGCAAACGCTAGCGGTGTCAT
TCCGTCGTGATCCAGCTGCAAGTAATCTGCATCCAcggcaagaagctcttcGATTGCTCCAGCATAGTTATGGCGTGCTGCCCAGTGCAGCGGTGTTCGT
CCATGACTATCCTTAGCATTGACATCAGCACCACGTTTCACAAGCTCACTAATTACACGCTGCCTCCCCATTACGGCTGCCCAGTGTAGAGGTGTACGGC
TGTGCACACCGCATTGAAATTCGCCTAGTATGTCCGGGCTGATACCCCACGACAGCAAATgttgcacagcagcaaggtTTCCCGCAGCGGAAGCCTCGTG
TAGAGGAGTGAGTGCCACGTCAGCACCCCACTCCTCAAGCACTGTCGCTAGTTCGCGACGACCGGAGAGCTGTGCGCGTTGAAGCACCGTTGTACTGGCG
GCGTTTCCACTTCCTGGAACCAGCAGGAGATTGGCTCGGTGTCTAATAAGGCACTCCACGACGTCGGCTGAGTCTGCTAAGAAGATTGGCGTGACACGCA
TAGAGCGCGAGAAAAAGCTTGACCGAGCCAAGATGTCCAAGTTAGCCCCAAATTTCACCAGAAGATTAATGACCTGCGTGTGACCGTGCAATGCAGCCAC
ATGCAGGGGAGCTCCCAATACGTGCGTCACTTTCTTCACTCGTAGTTGGCACAActcgtacagcagctccaaatTGAACGTTGCACCAGAAATTTTGTCG
AGAAAGTTCGGATTCAGACCTgcctcaagcagcaccgaGACAACGCGCACGTCGCCAGCACGACACGCCACATGCAGCGGGTTGTGCGTCCGATGTGATA
CCATCCAGCAGACTAGCGCTGGCGTGGTGTACATTCGATTGAGCAGCATATCCAGCTGCACCTTGGATCCAAGCACATGCTCAGCACGCTCCAACAGTTT
CTCCACCGCTGCACAATTCCCACCTGCCGCAGCATCATACAATGCACCGCGCAGCTGTCTCTCCACCGTACGAACGGtgctctgcgtcgtcgcccacGGA
TGCAGCTCTTGATTCAGTGTCAAGTACGAGTCCACGTGATTCGATTGCAAGGTCGGCGTATGCACGCCACTCGGAGCGGGGTTCCTGTCGCCAACCGTCT
CCacgtcacctccagcagctgcgttTCCTCCCGCCAGTGCCGTCGGTGCCAGTGCCATCAATTCATCCTCCTCCAGACCAGCtccaagttgcagttgctg
atgAGCCCGTAGCCGGTCAAACTGCTTCGTGTGCAGTGCAATAGTGAGAATTGCTAACAACGTGACGTACGACGTGGAGTCCGTCCAAATGGCCCACACT
CCTTCCTCCGTGAGATCTCCAAAGGCCCAATAGACTCCCAGCATCAGAACCACGATCCACGTGAGTGACACCGTCTGCACCACTACAATAGCCTCGAAAA
TTGCCAGAGCCAGCGTGCGTTCCAGCGTCACCCCAGGGGAGTCAAAGGCCGAGCGCGagagcgagaaggagctcacgGAGCGTGTTCCAAGCAGCTGCTC
GCTCGTCGTGGCCACCGCCGTCGTCACCTCTTCAGCGCTCGGAATATCGACCACGCGCACGCGGTAAAGAGACACGAAGGGCAGCGCAGCGAGTCCCAGC
GACACGTTGAGCGCCTGCAGTCCGAGCCAAGTGTCCAGCACGAACCCCTGtttgctggtgaagaagagcagcagcagcgagccCAGAGACAGCAGAGAAG
TGCCAGCTACGCGCCACGTGTAGTACGAATTGGACCATTGCAGATACGCGTCCGCTCCTCGCCACTTGCCGCTagaaggagacgaaggaggCGGTGGCGA
CGTTGGGCCAGACGCACTTGCAGCCATTTCAAAAACTGATGTGGGTGGAACATCGATTCGGCTGAAATAGATTAAATGAAGTATAGCGAATTCGGGAGGG
TCTGTAAAATTTGAtcgctattaatacatgGATATATCCATGGGTACCAAGGATGAATATGAGTCCCGGTTGTGCGTAACGCACaatctgctgctgatcg
TGCCCCCCACCTTCCTGCTCAGTTATCTATTTCCCGTAATacttgaagcagttgaaAACCTTGCACATGCAGTAcgttggttgttgttgtaatacgttgc
agctcttcgatgTGCAAATATTCAAGCCGGCAATTTGATGAAAAATAATCGTCGGTGTATTGTACTCGCCAAAACCGATAGTAGGTCATGGTATCGGATT
GGAAGATTTTAAAAGCAGCTGGCTTCAAGTCCCTCCCATCCGATACAAGCGGAAGACTGGCTTTTGAGTCGTTTACGCAAGCGCTGTATCAAAGGCATTG
GTTTTTTTCAATGCtcgctgtacatgtacgcgtGAAGTTCGTCGATCATCAAGCTGAGCGTTCTTATGGCCTTGCCGGCATCAGCCACCAGACGAGTTCC
TGGCTGGTAAACACGCATCAAAGGACGACAAAAAACGATTGGCGGAATATTTATAGCCAATCGCAGTGGACGGGCCCGTCTGCACGAAGCTGCCGGAACT
TCGCAATACTGGATGATTGCAATCTAACTAACCTCGAGATACATTTTCCAGCATACAAAAGGCGGTCGGTCAACCAATCAACTGAACGCCTCAACGTCAT
CTTCAGAAGGAAGAACACGGGCCAAGGAAGAGTGCACACGTTGCACACGCCGCCGGCTCTCACAGACCCCTGACAGAGCTCCAGACAACAGGACCCACcg
cagcagacgcacaaCCTACTCATCTAGACGCCGATCCTCTCGCGCCTCTCAACAGATCAGTAGAACAGCAGAAAAACAGGCTATAAAGGTCATGGCCAAG
CGCATTCGagtggccaagaaggaagTCGCCGTGCCGGCACCCACAGGCCTCACAGATGCAGCGAAGACGGTGCCAGCGCTGCCCAATGCAGCGAAGACGG
TGCCAGCGCTGCCCAATGCAGCGCCCAGGGGTAAGGCCCCCACGCCCACGAACGCCGAGGGGAAACACGCGATGCTGCCCGCGTTCCTGTCCAAGACGTA
CGAGATCTTCAGCATGCCCGAGTTCTCGCACGTGTGCGGCTGGAACGCCACCGGAGACACCATCATCGTGTCGCAGCTCGAGGCCTTCGTGGCCATGGTG
CTGCCGCGCTTCTTTAAGCATCGCAACTTTCCGTCTTTCGTGCGCCAGCTCAACCTCTACGGCTTCCACAAGACGGTGCTGGACTCGAAGCGGCTGGAGT
TCCAGCACCCGTACTTTAAGCGTGGCCGGCCCGACCTGCTACACCATATCAAACGCAAggtctccagcagcaaccaccacaaccagcagctcgtcagcaC
GTCCATCCAGGTGGCTACGCAGTCGGACGATTAGAGAGTGTGTTGAGAAGGTTCTTACTTATTTGTTTTTGTGTGGATACTACGAACAGAACTCGCGACT
TGATGCGCATCGGGAGATTTccgacacgctgctgcgtgagatgaaggagctgcgtcaACGTAGCGATGCCATGGAGAAGCGTCTGCGGGAGGTGGAGATA
GACAACGCGGTACGGGCGATTGGCTGTACACAGTTCAGTTGCGATACAACGACGGAAGACTGACATTTGTGCTGCTATTTTGCTACTGTGATGACAGATT
GTGCGGAGCGACAACCTGAAGTTGTGGAAGCACCTGGAGTCGGCGAAGGACAAGCAGTTGGTCatgcaggagaagatgaagaagatcatgtGGATCCTGT
TCCAGATCTACCGCGGAAAGCAGCAGAACCTCCCCAAACTGCCCAGCAACGACGCTACTGGCGCTGTAATCAGCGAAGAGTAAGTGTCGTGGGCATGCTG
CAAACCTGAGTATTCGATGTGTGACTAACCattttttgctgctgtgtggtATTTTCAATTCGTGTCTGCTTCGTGTCGGCTTCGATCTTTTCATTGACCT
ATTGGTAGCTACACCAACAGCAGTATGCTTGGGCCGAAGGAGTTCCGAGACGTactgcgcttcttggcgatggATGAGCCGCCAATGTTGCCCGGATCAT
CCGCcaatgttgcagctgcaacgccaGGCTCGCGAAAACGGAAATTTGTTGAAGTGCCGTCAGATATTGGCGAGGTGCTCACGGCGGAGGATGCTCCATA
TAAACTAGGTACGCTTGTCAGTGTTTTGCGATGTGATCGACGTATTTGCAAGAGTCAGCTAACTCGCTATTTTGTCAGATATAGAGCCATCTTCAGTTGT
CGAAGTGCCCAACTCGGTGGATGAATCCAACCCGTTTGCCATGACTGTTCCGTCTAGCACGTTCCCCGTGGCACACCCAGACGAAGGACAGAACAACGTG
CTGAGCATCTTCTCGCCGATCAATGCGGTTAACAACAGTGCACCCAACATGGACCCAACGCTGGGTGGATTCCTCACAAATGGAGTAGACACAGCTTCGA
CTGTATCTGCGCCGACTGTATCGACACCGACTGTAacagcgccaacagcaacGATATCGACGCCGACCGTATCGACACCGACCTTAAGCACGCCTGCTGC
GAGAAACGGAAGCCAGTCACCAAGTGGCAATGCAGCCGCTTCGAATGGTACTTCAGCTGACTCGTCAGCGGATGCAAACAACCAATTGGCATTTTTGGAC
GAAGAGCTCCCTTTGCTGCCCGAATCCGACCACTACAACTTCTCTGACGGAGAGCAGGTACTGTAACGCGTCCTGTGATTTTGTTTGTTTGCATTAGTGT
TTGCCTCGTGGATAGTAGTGTAATGGTGTGTCTTTTGTTGGGCTGCGTATTAGCAGGCAGTAATGAAGAAACTCGAGGATTTTGAGACGTCACTGCTGGA
CGAATACGACGTCAGCTGTCTTGAcacactgctgcagcaactgaaAAACGCTGGTGGAGACAAACCAGCGGACATTCCAGTGGCAGATCCGGAGGAGGTC
GTGGTTGGACCAACCAACGCGTCGCCGCACGATGCCTAAATCGGCGATGTTGCGGCTACTATCACGACAATAGTTCTGCTCTTGAAGCTGGTGATGTCTG
TGACGCCTACCTCATCGAAGAAGTTACGTATCCATGTACATGTCTAGCGAGTTCCCGACCCACGCGTGCTGTCACCGGTAGGAGTTGTGCAGCGCTGCTA
CTCCTCATATCGGCTGATAGACAAGCGATTGAGCGGGTCGACTTGCGTCTCCTCGTCCGGGTATAGACAGATCGAGTGTCAAAAAagtcaagaagaagat
catgcgGAGCGGTGggagcagagcagcatcCAGATCGCGAAGCGAAACCAAGAGAGACGGAGACGAGTTCGTACGAACAAACAGCCAACAGTTGATGCGA
TAGGCATTCGACGGCAGCGAACGAGCGCTCCGAAACGATGACGAACCCATACACACGCGGCTGTTTTTATTTATGCTATGAAGCGAGAATCGAGACAACC
AAACAAGAAAACAAGAAAAATGGTTTAGTAAATACCCTTCATGTCATGTTCCTACTGCGTCCTTCATCATCCTCTAGGTGCTGGTTCTCGACTTTCCAAT
TGACTGACTACGCAGTCGTTGgatctccttgtccttgcgGCCGAGTTCCAATTGCGCCGTGGCGAAGAGTGTGGAGATGTTGGACTCCAGTTGTTTGTGG
GCGGCACCCAGCAGTCGGTTCTGCTCCTGCAACTGCGCCAGTTCATCTCGTAGTCGtgcgttctccttctcgacctGTGTTTTGAggtccagcgcctcct
tcttctctaaggcgctggtggacgtgtCCAAGTCTCCGTACAGGTCTTCCTCTGTGCTCATGGTCGACGCTTGTTCAGAATTGATCCATATAAACTCCCA
GTCATAAGCCGTTCGGACTTAAACGGAATCGTGGTATATCCGTGTCACGATGGACTCGAGGTGCGTCAAGATGGCCaggcgctggtggctgctgtctCCA
GTCCAGACGCCGCCGCTAGGATAGAGCAAACGCAGGGCAAGatcttcaaggagctgcgtACCATGAGtcgcttcctgcagcgcaACCAAAGCCAGCGCTT
CAGCGACGCGGCGCAGCAAAAGCTCGTTGACTGTGTGGGGCACTACGTGGGCAGGGAGGCGCAATGCTACCAGTAGCAGAAGCCACGTTCCAGACGGTGA
AAGACGGACTGGCAATGCCGTTCAATGTCGTTggcaccaagcagaagaaacgACTGCTCAAGTGGTACAACGACCTCATTGCAATTGTTGGCGGAGACCC
GGACGCGGCGATAGCTGGCGAGGTGGCTGCTGATCCGAGCATTGAGTGGAGTGTCATGGACATCGACGAGGACAGATTCCTGTCACTCATGCAGGTGGAA
ACAGGAGAGACCAATGAGAGTTTccaggtgaagaagaagagtgcaGAGTACAAACGCATCAAGAAGGCACTAGAGAGCCACGAGGTCACCGTCGTTACCC
GTGGCGACGATATCGAGGAGATCCGCGTCGAGGATGAGTAAATGTAACAACTTCGAGCCTGCATGTTAGAGCATAATTAATGGTGTCCGCAATGCATCGA
AAGTTGACCCCATCAGGCGTTGCCCTTACGTTGCTCACTTAGAAGGGGCTAGCAGCTCCCGTCTTCTCGCGACTCTCGCTCCACGCCTTGGCAATGGTGC
GcttcatctcgtcgtcgccatcgtcgtaCATGTTCTAGggcagaagaagcacaacaagCGTTAGTCTTCGAGATTTTCTCCAAGATCCAGCCCTGCTACC
ATAAGATTTGTGAACCCACCTTCATCATGTCCATGATGCCCGCACTCGGGTCGCTCGTGTCGGGCTTGCTGCCCTTGAGCGGGTTCTTGGCCGTGAGGTT
CATCCACGTGTTGTCTTTGTCCGTCTTGTGCAGTGAGATCGTGACGCGGTTCTTTTTGACGCGGAACGAGCTCTTGGCCGGGtcaatctccttctccaag
tgctgcttgaacagcCTGCaagccagcaacagccacgTCCGTCAGTCCATCGTTTCCTTCAACTCCCTTTACCACTTGGATCTGCACCTACCGGTAGTTC
TTGTTCTCCAGTCCAATaatctacaacaacaacagcagcacaccaTGTCAGCTATTTATCATCTATTACCAGTAATAGCTGCATgccactgcaccacctt
cAGGTCGAACGACGTCTTGGTGAAGTGGCAGGTCACGTTCTCCTTGGGCAAGTTGCCCACGCCGTCGATGCCCGACATGACGTAGACCGCCACCTTTTCC
TTGCCGTAGCCGTCGTCCTCCCAGCCGAAGCGACTGATCTCCGTGAACGTCGTGGGGTCGCTGACGACAGGGCGGGCCGCCACCTTGACTGGGGCCGCTG
GCGTCTCCAcctcttgttgctgcggttcggcagcctccagcgccttctgcttACGCTGCAACAGATGCTCGAGGTCGCGGCGGTTACCGGCCGTCTTGgt
ctgcgccagcagcgtctgcagctcggcgactTCCGCTGCCAAAGCTTTCGCGTTGACTGCCATGTTGACCAGCTTGTAAGATCCGAAATGGCATTTATTT
GTGGCAAAAAAGATCGGACTATATTTGACTAGGTTTTAGTATCGTTCGCTTCAGTTTGTGTAGATGTATATTTTGTGAGCTGGTGTTTCGCAGGAGCAGT
TCTTTTTGTATTGCCAAGTCATTAATAGCTGGCGCAAAGGATGGAAGAAAGAGCGCCGCTCTCGGTCGCTGCGGGGGCTTCAGGGGTCGTTGCGCTCGTG
TCTCCTCCCCCGATGGACGTGAAAGAGGCTTCTTCTCTGCCGGACAACGCGGAGCTCGTCGCTGCGGCTCCTGCAGCCCCCGTACAGGCCTCACAAGCGA
CGTCTTCTGTCTCTCTCCAGTCGACGACAGATACGACTCCTGGTGGGTCTCCTGCGCGTCTAACAGCGGCGTCCGTGGCGCAACATGGACATAAAGAACC
TTCCAGCAGTCGAGATCCGCCAACGACGCCAGAAACGGCCTCCTCCGAGAGATCCGCGAGCGACGGAGAGCCGACTCCCACAGAGAGCGAGAAAGGCGGG
GCTGAGACGCAAAATAACGGTAACAGAGACCAAaatgcagcgtcgacagctGCTACTGGAAGTGGAAACGAGGCTGCAGGTCAACAGGAGGAACAGGGCG
ACTCGGCGGCAGGTCAGGGGGAGGAACAGGTCGGCTCGACGACAGGTCAGACAACAGGGACAGGACAGGAGAGCTCTTCTGCCAGTGCTGCTACAGACCT
GCAGGCTGttgcggccaagaagaaggctaaAATATGGTTCGACGTCCTGCCGATGGTGCTGCACAACTTCAAAACGCACAACCGAGAGCAGATCAAACGT
ACGCTATTTGTTGTGGATAAATCCATGGGTGATTGATTGATTCTGTGACTGATGAGGGACTGTGGGTTTTGTGTGTGCAGAGCTGATGTTGCCGCGGTGT
GTACTGTGCGAACGCGGCAAAGTGGACCAAAAGGCAGAAGCCCAGTGCAAGCAAGAAGGCTGCATTTTGTCCGACCGTCCGCTCTGTTCACTATGCTGGA
AATCCACTCATTCGTCAGAGGGAGCACGGAAACATCGTCGACTTTCGGCCTCAAGTGAGTTTCTGATGGGACATTCATCGCGGAGAAATCAATTGATTAA
TTCGTTTTTCTTGTGTGATGCTGCAGTTTGTCAGCAGTGTCAACTCGAACGGACAGCGTATTGGTGTGCAGAGTGCGACTTGAAGTTTTGCAGAGAGTGC
TTCGAGCAGATTCACAGCGTGCCCGTTACTAAGAACCACCGCAAACTTGCTACAGAAGGTTCGTATATTTTTTTATTACCAAGAGGCCCTCCATGCTGTC
GGCAATATTTGTATTTGTTGTGTGGATCACTTGAGCTTACACACATATTTCATTTGCTTTATCGTTGGCAGATGCACCCGGAACCTGCCTAGCAAAGTCT
CACTGGTCTCGGAATTTCCAGAATGTGATTCTTCAAATGGTTGCAGCGCGAAAACATCCACCAAATGGCACTactggtggtggcagcaTCAATGGAAAGC
GGAAACGCGATATTGAAGTGATCGTtattgatgacgacgacgacgatgaaaatgaagcaACGATCAATAACGTGCAAGCTGATTCATCGCTTGGCAATGG
AACTTCCGAGCAACAGGTTACGGTGAACCATCAAAACGGCAGCAGTACAGGGACAGAGGATACTCGTCCCAGTGAAGTGTACATTCAACCACAGCAGGCT
GCTTCTGCCAACATCTACTTTCAGGCTCCAGTCACTCAAAACTCGACGATACAGCCTATTCCGTTCCCCCAGGAGTTTACCGAAACGGCATTTTCAATGT
TGAACGGCGCCAACACTgtcaacatcaacacgaaTGTGGGGAGTTTGCAGTGGAATAACAGTGCGCCTCAGTTCGGAGCTTCGTCATCAATGGGaaatgg
aagcagcagcacggcctTCGCGACGAGTGTTATGAGCAATGGGATGATGGAGGTAACACCAAGCTCCATGCCGACCACTGTGAACACATCAAGCGGAGTG
TGGTCGACAACATCTGCCATCAGCACAGATTTGGCTAGCACATCCAATCCCATCAATCTTCTACCCCTCGGTGGTGCCGTCTTTGCGGAGAACGCGCTGG
TTGACTCATTGGTGGACCGCTATCATGAGGTGAACCAGAACGTAGCAAATATGGAGCTGCAAAGTGAGCACTTAACCAGGCAGATAGCAGTTGCAACGTG
CCATGGACCGTACAATGCTGGACCCATAATGGCCTTGCTGAGCAAACTGCAGCCTGTActagaagcagcaagaaggcgacgcGACAAGCTTCTTATCGCG
ATGATTATCCAGTCCAACGATATCATGGCTTCTGTGCGTCTTCTACGCCTGACTGAACTCGGCGATGTGCCGCAAGTCCCCATGATAAGCCATCGTAAGT
GTCTGCAATTATCGAACGAGATCAATCAGCACAAGACGGAGCTCATTGAGCTGAATCAGCAGCTGAGTGAGACACTTACCCAGTCTAACGAAGTAAACTC
CAGCTGGGAGAATACGCTCATCCGAACCACCAGCGCCAATATACAGATGCACGAGAAGAGCATCAAGAAACTCAAGAAAGATCGCGAGGTGGAATTTGTG
CGAATTGTGCAGTTCAGTTGCCACCTCCGTGAAGCACTGAAGCACGCATTTCAACGGAGTGTGGAGGTAcagcgtcaacagcagcagcaacaacaacgac
agcaatTTCAGCCATATGGATAGTTTTTGTAGGCCGAAGGATTGCTGCACAATGGAGTCATGTGGACTGATTCAAGCAACAGCCACAGCGACGGAGCCTC
AAAAGCAACTGTGGTCAAGAAATGGAGCACAGGATGTAGGCAAACTGATTATTTAACGAGGCACTCAATGCAGAATGAGCAGCTGTGTCAACCATGCCGA
TAGACGAGGAAACCAATCTGACCCACGAAGAAGTACAGCATCCTGCAGGTGGTCAAGCACAATGAGGTAAGCGAACAATTCACAAGGATTCAAGCGCAAA
CGTCGTTTAAGGGCCAAGGTTGCGCTTACTTTTTGACTTCATGCGAGACGAAGGACCCGAAAGATTTGCCCACGATGACGTGCCACGCGCCTTCTTGGGT
CTCCTCAATGTCGTGCTTGATCTGCTGCGCAACCTCTGTGAAGTGGTTCTTCTCGCCCTTGTACAGCGCTTTGAGCGCGTTTGTGGCGCTCGTGAGGATA
AGCTCTTCGAGTTCCTTGGACGTGTCCTGGTACACGATTCGTAGACCGCCCACGGCTACGTCGTCCTTCTTTTGGGTCTtggacatgctggaggaACTCA
CGCTTGGTTGTATCTACTGCAGATCTTTCGGTTCACGACCGTTGACCGCTTCTAGCTAAATCGAGCAAGCAGTGCGTGAGTTTTTGGTCAAGTGCAGAGG
CAACTTGCTGAATAAGGGGTCATGTCGAAGCGCAGGGGCATCTACGAGCGTTTGGTGGAGCAAACCGTGCGGAATGCATTGTTTCGTGAGCACGCCGGGG
AAAAGCAGGCTGGTACCTTGAAGGGTTCGAGCGATAGTGAACGTGATACCACCAAGAACACAACCACGACTGAAAGTCGCGAAGGCTCgattcttcagct
gctgacCAGTGCTAACAACGAACACACCGAGGACcctgctgaagacgaagaggacaaTAATGCTGGTGAAGCTCGTCGTGGTTCTTGGGTGGCGGATTGC
CCGAATTGGTCCATCGAGCGGCTGAGAGGTGAGAAGGCTGAAATCAAGCGCTATCTCAATGCACAGCGTCTAAAGTTTGCCGATGACAGCCAGAAAACAC
CAAAGTTGCTAAGTATTCACGAAGCGtacgcgctgctcaagctttTCCTACTTGAGCGAGATCCCGACTATCGTCAGTGTCTGCAGCAATCTATTGGCTG
CACTACCACATTCCTGACGTCGCTGCATGTGCTGCTTACACTGTACGCGACGTACTTCGAACGTGCTCATGGAAGACAGGTACTGCTGCCATGTAATTGT
ATTGTAGTCTCTTATCTTCATCGCCTTAAGTCTGACATGAACATGTACGCTGTAGATCTCTGAAAAGACCGATGTGAAGCCTATCGAGACGCTCTATGAC
TTGTTCCTCACATGTCGGAGCAGCAACTCCCCAAGTTAGAGAAGAGGGAGAGGAAATGAAGTGCTCTTTGCGTTTGATGAAGTTGCATCTGTGTCTACAC
GTACGAGCTGTGCGTGGGGATGATATCGTCCTTCTTGGAGTCCATGCACGGCACCGAGAGCCACGCGTAGTAGAACGCAGCGCCGCCCAGCATGTGCATC
AACCCCTTGGCGAGTCCCAACGCCGCGTGGTtctcatcgtcgtcgaagtagaTGGCAATGGAGCCCACAACTGTCGCAGCAACGAGACACGCCACTCCGT
ACACCGCGTTCTGCTTGTTCAAAGGAGAAATGTTGTTGCTCGGCGTCAAGAGCCGACGGTAGGCGACTCCGAGCAGGTAGCAGACCACGAGCAGCCCCTC
GTAGAGCGTCGAGTCCCATCCGTCCTTGGTCTTGAAGAGCCAGGCGCCTGCGAACGCCACGTAGCGCAGTACAATGTTGCGGTTCTCGTCCTTGAAGCCC
ATGAGGTGCACacagagcagcaggaagtagGCGATGGACAGCACGTCCGAGATGAAGTGCCACTCGTCCTCCTTGAGGAACAGCTGCGTGTCGAAGGCCT
CGGCGGCATTGAAGCAGAAGGCAAtgaccagctgcagcacgcccacGAACAGCTCGAAGTGGCGCCGGTTGCGCTTCATCACGTCCAGCGCCGGCAGCAT
GGCCGCATCCGTCAGCGCCAGGAACACGAAGCGtcccagctccagcagcattttTCGATGGCGATCGAAGTGTAAAAGTGACTATTTTTAAACTCACCCC
CTTGCAGATATTTAACCAATCCGAATGCGAGGAAGCATGTGCACCTTTATAAACCGATGAGTAGTTGAATATCGAATTGGACAATCAACAAGTTGAATGC
GAATCCagttgtcgacgtcgacgatgacgatcATTTCGCAATCTGCGCAACGCCAGACTGGATTCAAGTGTAAGACTCAAAGACTATGACGGCGCATGGC
TCTAAGAcggctctgctgctggacggcaaggCCACGAGTGAAGTGATCCGCACGCAGCAGTTAAAGCCGCAGTGCGGCGCCTTCTTGGAGCGCTACGGGC
GTCCCGTGGggctggcggtggtggtcgtgggcTCCAACAAAGACTCGGCCACGTACGTCCGGATGAAGGTAAAAgcgtgcgctgctgcaagcaTCGAGTC
GTGGACAACGCGCATCTCATTGGACCaagacgacaacaacaagaaacCTGAGGATAAAGTGACCAGCCAACTGCTGACGACGATTCAGGAGCTCAACGAG
CGAGCGGACGTGGACGGCATCATCGTGCAGCTGCCACTACCCTCCTTCTGCGACCAAGACGCTGTGCTAGCCACCATTGACcccaagaaggacgtggaCG
GGCTGCACCCGGAGAACCACGCGAAGCTGTTCCAGTTCGCGACCAAGAAGGCCCCGTCTCAGCACGGAGAAGCCTCGTTCGCTCTGCCCTGCACACCTGC
CGGCtgtctcgagctgctggaccacTACAAGATCCCGTTGGAAGGCaagcacgtggtggtgctcggGCGCAGCCAAGTCGTTGGGCTGCCGGTGTCgttg
ctgtgtctgcagcgCAACGCCACGGTCACCATGTGTCATTCGCGGACTCAAGACCTTAAGGCGCGTGTACTGGAGGCCGACATCGTCATTGCGGCTATTG
GACGCGCGCGCTTCGTGCAAGGAGACTGGATCAAGCCTGGTGCGACGGTGATCGATGTGGGTATTAACCCTGTGGAGGACGCGTCCAAGAAGAGCGGATA
TCGTCTGGTGGGCGACGTGGACTTCGATGCGGCCGTGAAAGTCGCACATGCCATCACTCCTGTGCCTGGAGGCATCGGCCCTATGACTGTagcgatgctg
ctgaagaacacCATTCAGTGCGCAACGCGACGTGTGCAACAACAGTAAAATACAAGGATGGAAGCGAGACAattcttcttcggcgtctGGAAAATCACCC
TGGCCCAACAAGCGCATTATACAACCGACTTGCCCGGCTTGGCTGCTGATCCTAACTTACCGGTAGTTGGTAAGGCGACATATTGGAGTACAGCATTCCC
TGATCTCCGCGATGGTGTTGTCGCTCTCTTCATTGACATGTGaatgtgttgctgctgctagaaGCTTaggtcgttgtcgtcgtaTCCGAAGAGCAaatcg
tcttcgtcctctgACGAGAACTGCCCGCTCtcttccacgagctgcacgtcTTGGTGCAGTTCCTCCCAGTAGCCTCCGTGTGATTGCTCAGCTAGGGATG
CTTCGTGCTCACTGTTTGCACCATTGGTGTTTAGATCGGTATCCTGATCACCAGCGTGACACGAGTGGGCTGAAGCTTGCCTTTGGTGGAGATGGTTcac
agcttcctccagcCTTTGCAGCGCTGTCTTCTCACTGGCTGGACGATTTAGTccaggttgctgctgttggtctTTCGGTTCGCCTGTGGAGGTAGCTCCA
TACCGACGTTGTgactgaagcagcagtcgcaTGCAATCCAGTTGGCCATACGCTGCAGCGATCTGCGCGGGGGTCTCCCAGTCGGTGTTGGCGAGTCTGG
GGTCTGCTCCGAGCGCCATCAAATTCTgtgccacagcagcacgacctGAAAAGGCTGCCCAATGCAGTGGGGTGTCACCTCTCTCATCCGCTACATTCAC
GTTCGCTCCATGTTGAACCAATCGAGAAATGATCGGAAGTGCAGCCGGTGATTCCACTGCATAGTGCAGTGGAGATCGATGCAGGTCGTCAGAAGCGTTG
ACGTTTGAACCCCCTCCAGGAGTCAATAAGAAAGCTGTCATAGCTGCATCGTGCGCTAGTACGGCAAGGTGCAGAGCTGTTCGACCTTGTGGATCACCTT
GAGCTTGGAGAACGCGATTCCATTCGTCATTCGCTTCGGTAGGAACCACCAATTGCTTCGCGCACTCGACAAACCCTTTGTCAACAAGGCAAAGCAGTGG
ATATCGCCCCGTACTGTCCGGCGTGTGAAGCGAGAGCTCTGCTGGTGCTAGTTTCGAGATCGTTTCGACCGGAACAACGTCCTCCGCGATCGAGTCTTTC
AtcatcaactgctgcaagaATCCACAGATCTCCACTTGGTCTTCCTCGCAAGCTCGATGCAGAACGTTCTGCCCTCTGTTGTTTGTCTTTAGAATATCAG
CTTCGtgttcgagcagcttctgcatGAAGTCGAGATGACCAAGTGATGCGTACAGCATCAGCGGCGTATCGCCGTTGCAGTCGACAGCATTGACGTTCAA
TTTCGCGTCACAACGGAGCAGAAACTCCAGCATTTCAGCTCGGGATCGGTAATTTTCTTTGGAAAACGACAGCATGTGGAGTGCATTGCGCTGGGTCTTC
GGCTCCAGTGCTCCTAGATCTGCGCCTCGTTGCTGGAGGAATATAGCGTCTTCCACCGATGCGTTGTCTACTGCGGTGAATATTGTCAATTCCTTCTTCG
TTCGCTGCGAGGGAGACGACGGGGCAGACTTTCCAGTCGGAGGTGAGGGCACTGACTTCGCATCTGGAGACGGTAGTAACACTGAGGCCTCCACGGAATT
GGTATCTTCTACCTCTAagagctgctgacgccgcATTTGAGCACGATATTGTCCCATTTGACGCAGCAGTTTGACGGGAAGAGGTAGCTCCATTTCCTCA
ACATCGTGATAGCAAAGTTCAGACCTCGCGTTGCCATTATCTTTCAAGTAAACTGGAGACTGAAATATGGGCAATGCATCAGCCGCGATCTCTTGGAGGA
CTTGGTGAATCTCCGAGGGCAAATACTCTTCGCTTGGTTCAAACAGTTGCAGCAATTTCCGCGTCATTTGCGAGTCGAGGCGAAGACGGAGTGGAGAGAT
AGCTTGGTTCGTATCACCATCAGAGCTCGATCTGTCCCagtccagccagccactTGCTCTCTTGAAGTAAAAGTGGAAGTGCTCGATGTGCATCTTTCCG
TCTAAATATCCCGGGTCCCGTGCTGAGATAGCAGCAAACGAACATTGGAAGTAGAAATTCATCTGCTGCCGTCTCTGATACTCCCGAACACGCCTTTGGA
GTACATTTGCCGCCTCATGGCAGAACAAGACCTGGTTCATACTGCGCGTTAAAATGTGAGGCAACTCTCTGTGACTCCAGTCTTCGACAGTCATCTCCAC
GGTAGTACGAGCCAAATCCTCCTTTGATACTTCTTGTAAGTCGCCAGGCTGGTCTACTGGTGCTTCCGCTGGTTCTTGAAGATTTCCTGCAGGCTCTTCA
TTTTGAGGTTGGTCTAcgggttcttcttcactcgCTTTGTCACTcagctcttcgtgctcaagcaCCTCTTCCTTCTGAACAACTTCTCTATGTGAAACAC
CTTTAGTAGCAATCAATTTCCTTCGAGAAGCAAGAGCTCTTTGAATTCGTTTCGCAGCCAACGCGCGTCTAGCAGCAAGCACCTTGCGTTCGAGAGCTTT
TGCCTCCTGGATCAAACGAAGCTCATCGTCCTTGACAACTGCACGTTTAACCTGTCGTACACCTTTGTGCCATCGCCGCCAACAAAGCTGCACTTTCGTT
GCGAGTACCGATACCAGGAGTCGATAttgtcgagcttcttcagcgcgtTTTGCTCCCAAGGCATCCAAGTAGTGCGTCCGGTACAACGTTCCTTTCCAGA
TCGCCTCGATTTTAGTCGCTGCACTCGCCTCCCGCCGAGTTTTAAGGTATCGTTTGACCGCGCCGGCGATGCGTCGACCGTAGGATCGCTGTGTGATGAC
ATCTACTTGTTCCTGACGCTCGTGTTCATCTCGTTGAAGCCGTTCTGCGTCAGGCCTGAGTTTCTCTGTCAAGCTACTACGAGGTTTCCGGGGTTTAGCG
TCTTCAGTCTTGCTCCTATTCCGTTgttcaagacgaagatgccaccacctcctccagtgCTTTTGTATCTTCAGTGCGTTTATGTTTTGCTTGTGCCGAA
GACGTTCCTGAGTCActcttcgtcgctggtgTGAAATTCCCCAGTTCCGTTGAATTTTAACAGAGCTTTCGTATTGTTCCTGTCGAATGCGTTCCCTttc
gagttcttcttgctgtccatGATACCACTTGAGCCACAGTGTTTGGATCTTGAGCGCAGCcatgtgctgctcgtgctgtaCTTGTCCCTGCTCCATTCTG
CGTCGATGTTGTCGTTTTCCCCAGTTCCGCTGAATTTTCACCGAGGACGCGTTTTGAGTTTGCACGAGACGCTTCTCAAGCTCACACTGTCGGGTCTTTT
GCCATTGGGTTTGGATGACCaatacagctgcagctctgcgcTCTTGCTCCGGGTTCAGTTGAGTTCTTTCACGTTGCGCTACGTGCCATTTCTTCCGTGC
TCGCTGAAGCAACATTGCGCTCATGTGCTGGTCTACTTGTGCACGCTTTCTAGCTTGTAGAACTTCCTTGCGGTGATGCCATCGACGCCACTTCCTCTGA
ATTCGTTGAGCTCCAAGACATCGTTTACGTGCAACGTCGTCCTTGTTGCGTCTGAAGCGCTTCCCTGTCCAATTCTGCTGAATTTTCAATGCAATCGCAC
GCTGTTCGTTTTCTTGGCATTCTCTTCCCGTCTTCTCTAGTGATCGCTGGCGCCATCGTCTTTGAATCCGCTCGACGGCGCGAATCTCATTTCTTACCTT
TTGCTTTCGCTGCCACCAGTGACAACAAGCATCGTGTATCATCGCCGAGCCTATCTCTTGTCTAATGCGCTTTCGTGTCTTCTCCATTTCATACCGTCGT
TTACACTGCCACTGACGCCAATTCCGCTGTATACGTAAGGCTGCCATCATTTGAGTTTTTCGCACACGCTCTGCttccatcttctccttctgccaCTTCT
CCCACCGCTCTTGAATTCTCTTTGCGCTTAGCTCTCGGCTTCGCTTCCACCAACACCACTGACGCCAAAGCTTTTGAAGCTTCCTAGCACAACTCTCTCG
TTCAATTCGAAGGCGTTGCTTCTCTTTTTCAGCTAATTGCCATTGTCGCCACCTCTTCCACTTCCTTTGTACCACTTGAGCGCTTGCATTACGCAACATT
CGGATTCGTTCAGCCTTGTCtcgctgctcctgctgccaTTTCCTCCACCATCTCTGTATGTGGAGAGTGCATGAAAATTCAAGCTCATGAATACGCCTTC
TCTCTCGTCGTTCTTGGTTGCATTTGACCCATCGTCTCCACACACTCTGAATTTTGCGTACAGTTGCTCGGACTCGTATCGATTCGAGATGTGCATCAAa
cgcgagttgctgctgatttCGTCGTTCTTGCTCGCATCGAATCCAGCGTCGCCACACTCTCTGAATCTTACGCACAGTGGCTCGAATTCGTATCGCTTCC
AGATGCGCATCAAACGCAAGCTGTTGTTGGTTCCTGCGTTCTCGCTCACGTTGCACCCATCGTCTCCATGTTCCTTGGATTCTACGTGCATTAGCTTGCA
GTCGTATTCCTTCCAAGTGTGCCTCAAACACCaagcgttgctgttgccttCGCTCATTCTCACATTTGACCCAACGCCGCCATGCACCCTGAATTTTCCT
CACGTTCACCCGGACTCGAATCTCTTCTAAACGTGCATTAAAGACAAGTTGTTGTTCGtgtcgccgttgctgctcttgaacCCATTTTCGCCACCAAACC
TGTAGTCTCCGTGCTAGTGCTTGACGCCgctttgcttcttcaagctgagcAAGTGCCAATGCTTGAGTGCGTTTGATTCTCAGCTGGTGCATCCATCGAC
GCCAACCTCGTTGAATCTTCCGAGCGCAATTTATACTCCGAAAACACTTCAGCCTCGCAAATTTATGCTTCTGCGCTTTGTAAAACCGCGCCACACCGTC
AAGGCCCTGGGTGATGCCTCTGTTGCCCTCGCGCTCAGTCAAAAGTTTGACGTCGATAATGATCTGCACTAATTGCGCTCGTGTGCGCCCTGCAACAACC
TTCTCCTGCGCTGACTTCTCTTGCTGTTGTATCCGTATCATTTCCACAGTTTTCTTGTTACGCTGTTGGCTCATGCGTTGGTGCATGAAGGCTGATGCCT
TTATCGACGAAACTTCGCGCATCTTCGCTTCGATCTCGGTACGTTGTCTTCGTTTTTCCTCCTCCATAGCATGTGCTGCCGAAGCACGGATTGCATCTTG
TTCTTTCTTGAGTTTTGATAGCTGCATCTGCCCTGAAACCCAGGAAGCTATCTGCTGCATCCTGGCTTCGACTCTGCTGTGCTCCAATGCCGCCGCCGCT
TGCTGGGCTTCCAGTTCCTTCTCCGCTGCCAATTGATGTTTGGCTGTTAGTAGCTCCTCAGATCGCGCTTCCAACTCGGACAAGCGCTGTTGAAGAGTAG
AAGCAATCGATAGAGCTGTACGACGTTGCTCAAGTTGGTCTTCGCTGGACATGAGTTCGATCTCTGTCTTCTCACTTTGCAGACGTGCCTGCTCCAGCAA
AAGCTTTCGTCGTTCACTCTCTGCCCTACTGCACAACGTCCGAGCATGAATAAAAGCCTTAATTTTCAGCCGAGCAGCACGCTCTTGAGAGGCACCTTCC
CGCTCTTGATGAGCTTGGACAATTTCGCGGTGTCGAACGTCCGTTTGCAATGCTTGTTGTGACATCCGGCCAACTTTCCGCTCCAGCACTCGCACCTGAG
TGCGTGTCTTGCCCATACGCTTCTGCGTCTCAACTCCTCGTACTTCCTTCCTTCGTAATTCTTCTTGAACCTTGGTCTCGAACTGTTTCTTCTCACTTTC
AActttctgcagcttcttgtgaAGAACGCACAGTCTGAAAAACATTTGGATCTTCAGTGCCGcgagtcttcttcgtcgcacttcaactgtatgctgctgt
tgttgtacAACACGCTCGTGGTGTGTGAGCAGTTGCAGTCGTTCTTGCTCGGATACCTTCCACCGCCGATCGAGGTCGGCCAGCCTGGCGTTCATGTCTG
CAATAAGTTCACGACGATGCTTTAAATTGAGTTTCGTGCTCCTCTCCTCGTCTCGCTTAGCTTTAGTCCACTTCAGTTGCTCCTTGAACAAAatgctctt
cgtcatctcctGAGCTGCTTTCAGCTTGCGACGCAGTAGAATTTCTTTCAAAAACCGTTGAATGTCCCTCCGAGCCCTTGTGCgtctctctctttctcga
CCAAGATGTTCCTGTCGCTGTTTTTCCTTTTTGATTCGCAAGCGTTGGTGTCTCCACCACCGAACCACCTTTTCCTTTGCATATTCACggcgacgccgtc
gtcgcgaAATTCCTACGAAGAGTAGTGTACGATGGAATGCCATGTGAACAGCGCGAAAACCAGCTTTGCGTTTAGCAATTCCTTGGTTGTGACGGTAAAT
CCTCCAATTCAGTTGAATTAGCGATGCTGCGAGGAAGCGAAGATGATTTTCTTGGTCAATCCGAGCTTGTAAATGTCGATGGCGGTGGTGAAGTACGAAT
TGTCGGACCTTCAGTGTCGCAACCAACCCGCGAACGACCAGCTTCGCCCGCTTTTGCTCTGCACACGCCACTTTCCAAGAGGTGAAGTTCCGCCGCAACA
TCTTCAACTCACGCTCCAAATACTTGGGGGTATTGTCAGCCTGAACTTTTGTCGTCGTGGGAGACGAGTAGCCCATTATCGACGAGAACGGCTGCGCTAC
GGACTGAATGTGGTCTTCGACCTCGCGCTGAGAGACCCAATGACTCATGTCATATGCTGCCACTTGGATGTCTCGACAAAGCGCGAAGATCCTCTTAAAC
TCGGAAGGTTCACTTTCATCGTCACCTTGGTAACCCGTCGCTGCTGAAACATTGCTACGGGATGAAGCAGGTATTGAATGCACCACGTCGTCATTGGTCA
CTGCTGGAAAATCGCTACGAGATGAAACAGGGGATGAATTCCCCGTTCTCTCGCTGGTCGGTGCTGAGCTGTAGCTACGAGATGAAGCATGTAACGAATA
CATTGCTTGGTCATTCGCACTTTCTGGGATACTGGTATAAATTGCAGAAGGAGAGAAGAGTGCCAGCATTTCCTCGATCTGTGGGCTCGATGCTTGCCAA
GGTTCTTCCGGTCGAGATTGATCATCTTCGATAGATCGGTAGGTGCTGATTCTGGGAGAATCGATATCCAATTGAGATTCAGACTGGTCTTCAGGTAGTT
GTTCGGGAACAGAGAATACGTCGTCTCTCCATACACTTGGCAGTAGACTCAGAGCCATAGCTATGTTCGACACAGCCGTACTCGATGAGTACGCGTattc
atcatcttcttgtgGGGGCATCTCCGCTCTTTGTTCGACACTTTCCAGTTCGCTCGAAACACGCTCCATCGAAATGCCAACTTCGTATTGCGTGGATCCA
CGGGTTGATGCAGGAGATGTGTTGACAATCAACAGTGTACCTGTCGCGATTGGCACGACAGTGCTTTCATTATCATCGGTCTCGTGCTCTTCCGTCCTAC
TCGACCCCATTCTCCCCAGCTCAATGGGCGGTATTGCTTCTTCAGGCTTCAAACCTTCATCGACAAGAGTAGATTCCATGTTCGACAACGAAAAGTTTGG
CAACATTTGCAACGCCAGCGCAATACTCGACAGTGCGTCGTTGGATGAGTACTCGAAATCGCATTCATACCCATCATCGTTACCTGTTGCAGCCTCGCCA
TCGCCTTCCACCTCGTATTCAACAGAAGAAGCGTCGTGATCTTCGGTGGTTGGAGTACCCACGGCATTGATCAACTCACTCGGTTCTCCATCGATTCTGT
CACGTGATAAAACCAAACGTTCTACTCGAGGTGAAGCAGGAAGAGTTTCAGGTTCTGAGTTCTCTTCAGAAGAAACCCGGATCGCTTCATCTTGCATTGA
TCGCGCTGAAGTATTTCTTGCCGATCCCTTCGTTGTAGGAATGTCATCTTTTGGAGTAGCAACTGATGTGGGCGGCTCGCTCATTTGAATtccagcgtcg
acgacttTGCTACGATCGTCACACTTCTCGATTGCAACTccgcttctttttcttgATGCAGATCGTTCCGCCTGGCTGGACGACTTTGCTTTTGCCGCTG
CATCGAACATGGGAGATGACAACACTAAGCGACTAAGAGCCACATTGTCACCCCCATCATTTCCTGCAGTTccttcacttccagcagAATCACCTCTAGT
AGACATCTTCCTTAAGGGTGGAGGAGAAACACTCAAAGACGAATTCATGGCTGCTGTCCTCCCAGATAGAAGATCACTTGGTCTTGGGTTTTGTGTCCAT
ACAGACGACGCGAGTGATGGTGTTCGAGAGTTTTCCTCTTTCTTTAAAACACTCCGGGCTGATTCATTTGGCAATGGTGGCGTCAACACCCTCGAAGACG
GCGGTCTAGCCTGGGATGGTATTGGTATTTTTGATGTTGGTGAACCAGCCCACGCTTCCATTACAGATATTTCACCCCGAGTTGGGTCATAGCCTCCTGT
ACGAGACACTTGAGAATCGTGATGATCCAACCGCTGTATCCTTTCATCTTCAAATGTACCATAGCCGTACGAAGTGTCCTCTTGTCCACGCTGttgatga
agctgatggTGGGAGTATTTTCTACTGTCGTTGTGCGACTGCAGATACCTCGGAAGCATTCGAACAGCATTGAAACGAGTCTCAAGATCCATCAAGTGCA
GTAACGCCGCTGCCACACGCTCTACCGGTAAAATTTGCCAGCCCAGGAGGTAACGTTGAGCCTGGAGCGCGAATGTCTCGAGTTTATGCATCAGTAATCG
CAAGAgggacgacgatgaagacgaagcagagcAAAATAAAGCACGGGACGATGCGCTTTGGTGGCAAGAGCAAAGCAACACCTCCGATGAGTCCAAGGAT
AATCCATCCACGAAAGGGTTGCGAGTCAGGTTCACCTCGAAGTCTTCAAAGAATCGCTGGAGTGGTGGCGAACAGGCTAGAAAATCCGTGTCGGAAGACG
CCATTTGCTGCAAGTACCCGTAAAAATCCTGCTCCAGAATTTCGTGTTCGACACTCACACCAACCACATTCGAGTCGCCAAgctcgctgctcaagtacac
CACAGTTTCCACTACTGCAAGTGACAGGCTACGCATCCTgttcaacagcttcaccactCGTTGCGGCACATTTTTCTCCACGTGAGATGCCCGATGCAAC
GGTAACACTCCCATAAGTTCCTGCTGTAAATGGGCCATCACTTGGTCGCGTAAGTGCATGTTTTGTCTGATTGACTCGATCACAAGTTGAGCCGGCGACT
GCTGTAGAGCAGATGAACGAATTACACGCTGTGTAGAGCTTGCACTTTCGTTGTGTGGCGATTGTTGCTGATAGCGACGAGGTGTCGGATCGTTTCGAGT
GCCTAacacctgctgcttcagcttgtacGGACTCGATAGCCGCTTggcatgaagctgctgcatctgacGCTCGGTACGTGGCTTGGCCGCCGTGTCATGC
GGGGTTCTGGACTGCGAGCGCGGCTTTGGTTCAGCGATGAAGTCTTGGTCATAGCTAGGCGGTAAATGCCGGTTGTGGCTTGTGCTCGCTGCATCAGCCG
GTCTATCAGAAGCACCATCCGAATGTCGTGGTGCGTTTTGTTCGATACCCGCTCGTAGGGTGCCTTGATACAACGAGTCATCcagttccagctccactAG
AAGCCGCTGTTGGTCGtggcgtcgacgtccacCGTGATCTGTAGCTCTGCGCGGCGTGGAATTTCTTCCGCCCCATAGGTAGGTCCGATCAGCCATACCC
TTTATAATTAGGCGTCAACTTGCCAAATGCTGCTCCACTCACCCATGAACTTCCATGACATGAGACGTTTCTTGAAAGCGTTTCGCTAACAGTCTGCTCA
AAAACCAACACATGAAACAATATCAACGAAGCGAGTAATAGCTTGTAGGCTAGATTGACAGCTCTCTTACGTTTTACCGCTGGCAATGATATCACGATTA
GTTCGATGTGTACCTAGATAAGCATATCATCACcttcatcctcttcaccGTTGGTTACAGTCGTAAGACCCTGGGCTCGGTACAGATCGGCAATCTGGAT
TCGACAacaagcaacagcaaacattAGTTAGCCGTGGTCTGTAAGCAATAGCAATACAAGCTCCAGTGTACCTGAGAAGAGTTAGTCGCCTGCGTAGTCT
CCTTGTCGTCACGGATGCGAATGAAGCGAGGGAAGCGCAGTGAAATGCccttgtccttggccacTAGACCGATGGCTGCTGTGTACTTCGGCGAGATCGA
CAGGTCTGCGCCTAGAATTTCCCACACACAACTCGCCTCGAACCAAACGTCAGGCTTGATTCCTTCGCCGATAGCATAGTCATTGGGAGGCTTGTCCACA
ACGTTCTCCTTCAGTTGGTCGTAGAACTTCTTGAGTACTTCATCGGACAAACCAGTTCCCAGCTTTGTAATGGGTTGGTACATCTCAGTGTCCGGGTCAT
AACATGCCAGCAAATAGGCACCATACACGCCAGTGCGTTTGCCACGACCGTGGAACGCACCAATCGGAACCAGGTCCGCCGAATCACCAATGCCGTCGAG
GTAatccttcttcagcttcaaccaCTTGTGTGAACGGTTGGCTGGCTCATACGTCGCCTCCTTCTCAAGAGTCTTCACCATCAAGCCTTCACAGTTCTCG
CGCACGGCCTCCTCCAAAAAAGTGCGGACCTTGTCCACAGCTTCTTCCATCGCCTCGGCGTTATTCTTCACATCAACACCATCCTCTACATCTAATGACG
TCGCGAATTCGAAGTTGCCGGGGTTCACTTCAAACATCTCGCGAATTTTTTCACGGCGTTTCGACAGCGGAGTGCCGAGGAACGATTCGCCGTTGAGGAA
CAGCAAGTCGAAAGCGTAGATACACACAGGAACCTTGATATCTTCCACTTTCACGTTCTGCAATTACGATACATGAGGAAGATTCGAGTTAAACAAGATC
AAACGATAACCAACTGAAACCTAGTGACGCACCTTTCGAGAACGCGTACTGAGAATCTGGAAGGGCAGGCGCTTGTTCGTAACACGATCAACGGCAACCA
CCTCCGCGTCAACGATACAACTCTCGACAACGCCTTCCTTGGCAGCGTTCGAGATTGCCAATTTGACATCAGGGAATCGCTCCGTAGAGTTCTCGAAGTT
GCGCGAGAAAATGGCCATTTCTCCGTTCGGAAGAATGTGGATCTGTGCACGTTCACCATCGTACTTGTACTCGCATGTGAAAGGTTTGCCTTCAAAGCGA
TCAAACACCATCGCGTACGCCTTGGTTGGACGTGCAAGCATGGGAGACACTGGTGTGCCTGGTGTCAGCACACACTTCTCGGCAACCTTTGCGAAGTCCT
TCACGCGAAGAAAAGGAGCGGAAGAAACCTCCTTCTGAACTTCGTAAAACGCTGCGACCAGTGCGTTGTAGCTTGGACACTCGGCAAAAGCCTTCTTGAC
AAAGACTAGAGCCTCCTGCTGTTTGTCTTTGTCCTTGTACTCTTTGTCCGTCATGAACGCGTACGTCAACCCCATTAGGATCGATTTTTCTGCTAGTCCA
ATTCGTAGCTTACCCTGTAGTCCACGAATGATGTACTTGGCCCCTTCAGCAGACTGTGCATCCTTATCTTGTGACTTTTTTTCCTTCTCGCACTTCACCA
GCAAGCCCTTGATAATAGAGCACTTCTGTTGTTGCGAGTTGTTTCCAGTCATCTTAGCGATCTTGACGAACTGGCTGTACACATGTTGGACAGTAAGCCC
ACTACCTTTAGAAGAGGCTGGTTTGAGAGACGCGAAtgacagcgtcttctgcttcgatCGCGCATTCTGAGCAACCTTACCGAGATCGCCCTCCTTGTTG
TACATTTCCTTAATGAACTTGAGATTCGCACCAGTTGCCTCGCCGATAGCTTTCATCAGAATGGCATCACCAATTCCAATCTTTAGGTTCTCGAAAGGCG
GTGCCAAGTCCACACATACACAAAGGTAGATGCAAGCCAACAGATCATCCGGTGAACGACGAATGACATCGCGGAAGAACGTGGTCAGCAGGTCCTGGAT
AACGAGACGGCCCGTAACCTCTTCAATCTTCGCGAACAAGTGCGCCAGAGCAAAGTACGGAGCCTCCCGTggttcgtcgtcctcttcttcctgctttTCG
ATAGCACCATCTTTGTCTTTCGCGTTCGCCTTGCTTTTtgcctccttcttgtcatcAGCTGGGGTCGATTTGGCCTTGCTCGTCTTGTTCGAGACAGGGG
TGAAGAAACCAGTCttcgatgcagcagatgccgcCGCTTCTCTCTTCTTTTCGGCCTTTTTAACTTCTTTCTTCAGTTTGGCCTCTTCAACCTCTTCAat
ctcgtcctcatcttgctcttcctcATCCTTCTCGTCTTTCTTTGGACTAGGCggcgtcaccttcttcttcttcttctcctccttctggAGATTCTTAACC
TTCCCCGGCGTCTCCGACTTCTTggtctctttcttcttgggaCTCTTGGCTTTCTCCGGAgtcgacgtcggcgtcgtcatgTCAATCATCTCTTCCTTCC
CCTCctttttcttcgtcttgtccATGGGCAGATCCAagtcgctgtcatcgtcctcttcctccacgaTGCTTTGccgcagacgacgacggccaGCTGCACC
ACACATCAGCAATAACAACATCATCAGCCCATAGCCACAGACTCACTGGATCAGCCAGCAAAAGACGAGCCACGTACGCTTCGCCGTGCTCTTCACAACC
TCCTCctctacttcttcttcttcatcttcttttgcttcttcttctttttcttcttctgcgtgTTGCATCTCTACATCTTCTggctcttcctccacctgct
cctcttcttcttcatcgtcttcgtatttttcttcttcttctttctcttgTTTCTTGGCTGTtctcttgttcttctccttcactgGTTCCTGTtcatttgc
tgcagttttGGGTTTCTTCACTGGCCTGGCGGGGGACTCGGTGGGTttctcgtcgtcttcatcttctgcaggTTTGCGCTTCTTTGGCGGTGGCGTCGAC
GCTCCAACTCCGCCGAAAAACGACGTGATGGAGCGCTGCGTCTTGggcgcagcagccacagcttTCTTCCCCATTCCGCCTTTTTCGCAATTGATTACAT
CCAAACCGCGCAAAGAAGTGTACCCAATAAACTTCGACAATTACTGTCGTACCCTTCAGTACGAATACCTCTATTATCATATTCTATTTTTTACCTGATC
AGTTAATCTCGCTTGGCATTTGACCTCTAATATTATATAGTCCTGTATATTGACAACACAAGTTATGAGTGTGAGGACTGTACATATATTGCTGTTCAAA
GCAATTTGGCGGGTGATCTTCCGGCACAAAATGGGCCGCAAACTGCTCGCGCTGGTGCCGTCAACGCTGCCGTCCGCCGCCAACTTGGGGCGCTTTCAGT
CGGACGCGACGGACGCGCCTTTGCTGTCTATCGTGCTGTGGAACACTCGCTCGACGCGGACGCGGCAATTGGCTCTGGACAAGGACAagcggcggctgct
ggagctgcagcgcctgcatcCGGCGGAGGGCGCGCGCAGCTGGTTCGTGGGCAACGCCGTGCTGCAGGACGGcggagtgatggtcttcTCCCCGTTCGAC
gcgctcttcgtgctgctggacgccgcgTGGCCTCAACGCGCGCGGTTCTCGTCGGTCTACGACCTGCTGGCGACGGATAGGAAcacgtggctgctgcagc
tctcgacgctgcgtgcggaggagatcgaggccaTCTGCGACGTGCAGACGGCGGGAGGCGACGCAACAGTGGAAGATCTGTACGTCAAGgtcaacgagaa
gaaggcgatgaaCTGGTTGAGGGCCAAAGTGGAGAAagtggcggcggtgctggccaaactggagcaggacgccGCAGCCAAAGCTGCAGACGCCACGGCG
TTCGATGAGCAGGTGAATCTGCCAGGACAaaagcaggagaagaagaaggagcaggagaaagaggaggaTAAGGATGCTGCACGCCGTCACTATCGAGAAG
CTATTGATGTCGTAGGGAACTACCTCTCCGAAGAGTGGATCGACCTGCTCTGCAACGAGTTCAAGtacgtcgttgctgtttCAGTGTTGTGTTGGTACTT
ACTAAGTGACGTTATGTtgattgttgctgctacctACACAgggtggagaaggaggtggaggtgaAGGTTGTTGCtaaagctgcagctggtggacCGCAGG
ACACGTTCAAGCGGTTCGACCGACGTCAGACCCCAGAGAACGGGGCCAAGCGCCCGACACCTTCCAGTGTGGGTAgtgccaagaagaagagcaagttgGC
CAATGTTGACCGTTCCGGAATGAAGTCGCTGACGTCGTTCTTCGGCAAAAAGTAGACTTGGACGGGGCTATCATGAGCAAAGCGAAGCATTTTCTTTAGC
GAATATATAGAGCTGTTTATCGTTTATCGCCGGGAGGTGGAGCCTTCCACGCTGACCCGATGCACTATCACGAAGTCGTTCCAGCCGGAAAGGATCTTGA
ACTTGATGAAGGACGCGTCGGTCGGCTTGACATTCTCGCTCACTATCTGCATCTCACCGTCGGTCTCCTTTAGTTCTGGGGCACAAGTATAAAGGTTAGC
TGGTGattcgagaaggagcagcagcagcagcagatactACAGTATTAAGCAGCTTACTGGTGGCAAAGAGTTTCTCCCATTTCGTGGGTGTCGGACCGCT
GCAGGTTTCGACGGACACTTCCTTGACATTTCGTGTCCACAGCTTGGCACGAACGACAGAGGCCGTTGTAGCAAGCTGAACCACGATTTCCTGGGGGAAA
CTCCCTGTCGTCACCCATTTCGACAATTGCTCTCTGGAgacaccgcagcagcacaagctcagACACTGATTCACGTCAAGTAAAAGGCAGAAGACGCTTA
CCCGTCCAAGATATTAACTGGTGGGAAGCTCGGATCGTACGATGTCACCGCCGTCACCTGGGCGCCCTCTTCATCCAAAGCGAGTTCCATCACGCCTACC
ACGACAGAAACCTTTTTGTGGTTGTAGCTGaacttcctcctcctctcctGAAGTCCCTAAAACTGCACAGCTTAACTTAGAACGACGCAACAGAACAAAG
CTCAAAACCAAGTAATAATAGCTGATCGTACTCATTCATACTTATCATCTCCATTCTGCACAGCATGCACTGGTGGATTACTTGAACACCCTCCTAGATA
CCAACGTCACAGATGGCATACGAATCTTTTTGGCGCTGTTGACCCACATTAAGGTGGTTCGCTAGCCCCCATCAACTCGGCAATCAGCATCCATCTCATG
AAGTCAACGGCGGTTCAATGGATTCTTTATACAGGCGTTCAAAGCCCGCTGACAGGATATCAGCCGCACGCGTGATGCCTGATCCGTCGTCATTGAACAG
CTTGCAGTTCGACCACATCAGTCGAATATCGTTGGCGAAGTGCGTAGAAGCCAGCTCCTTTACACCGGCCACCACTgtgttgctgtccacgatATACGCA
CCCTTCCTTAGTTTGTTCTCAATCTTCGATAAATCCATCGGTTGCTTCACCACCCGCGTATACATCGGGACATTTTCCACGGGCGAGAGGAACTGCTTTG
AAAATGGATGCGACTTCAAGCACTGGACAATTTTCAGACACTTGTCCAACAAACTTTTCTCTGAAGCCACAGCAACGGAATACGCGTCGAACCGCGACGG
TTTCTTGCACTCCTTGCACTGCCAATCGCCCTCAGGCAGATCATTCTCAGTCATGTACAGGCACTTTAAGTGGTAGGAACGCGGGCACTTGTCACAGCAT
ACCAGATCACCAGCGCCCTGGCAAACCTCACAGTAATCTAAGTTCGCGTCCAGTTCGCTGTCCGagccatcttcgtcttcctcctcctcctcctcctcct
cctcctcatcttcctcgttgtaggcctcgtcctccgtctcttcatcgtcattTTTCGCTCGCTTAGCGTGCTTGGGAGGTCTACCTCTTCCCCTACCTTT
TGGGGGCGGGGTAGTTTTGCGTTCTTGTGGGTTCTTCCTCTCCGCACGTGAAGTTGTTAAAGCTATAGTAGCTGCATCAGCATGTACTTTGCGTGGACGC
CCTGGTCCACgatgcggtggtggtggtggtgtctgcGCAGAATGATTTTCGTTCTTATCAGCCTTGGGTGCGATATCGTTCCCAGGGTCGTCTAACTTCG
TGTTaggcttcagcttcagctcggACTGGTGTTGACGCTGATCTTCATTATTATGTTCTTTTGTAGCACTTTCGTCACGATGCGCTACCCGAGAACCATC
TCTTGATGGCACGTCGTCCGAGCCACGTGGCGCTGGACTGTCCTCGGCATCGCTTTCACTAGCTTTCCGCTTCAGTGCTTGACTCTCTTTGACAGATCGC
GCACCAACACTTGAGCGATCATGAGGCGTGCTATCACCTGAGTCCATTAAGCTAGTGGATGATTGATCCTGGTATGGACTATCTGCTTGGCGACGCCTGC
CAGCAATCCCACGACCAGAGTATACCCGGGGAGATGCTTCCATTTCAGTATCGTCAGAGCCTTGCGCGTTTCCACTACTTCCATTCTTGGCAGCAATTCC
GTTCATACCGTAGCGTGATTCACTTTGGCTGTAACTACTGTCTTTGGTGGACTGGCTGCTGACACCCGCCGCTATCGAGCTCGCGGGGACTCCACTTTGA
TTTAACGAGCTCAACAGCTGGACCAGGGACTTCTCCGACTCGGCACAATTCAAAACGGTCGCTGCTGATGGTGACTCCGTGGAGCTTTGGTGAACTAGCG
GCGAGGCGACTCGAGCGGCAACTCGAGGATCAGCAACTTGCGCACTATCGGCCATTACAGAGAGTAAATCAGCGGGCGTATCCTTTGCTGCTCGCTTCGG
AACAGGGGGGTACTGAGACGGAGGCTTCTGTTGCGCCTGCATGCTGGAAGCTTGCAAGCTGGAAGCCTGCACGCTGGATGCCTGCACGCTAGAAGCCTGT
ACGCTGGAAGCCTGTACGCTGGAAGCCTGTACGCTGGAGGCCTGCACGCCGGAAGCCTGCACGCCGGAAGCCTGCACGCCGGAAGCCTGCACGCCGGAAG
CCTGCATGCTGGAAACATAAGCATCACGGCTGTTTCGCTCACCCATTGGATACTTCTCATATTCAGACTGCTGAGTCTGCATTAGTCTGCGTCCTTCATA
CGCTGTTTCTGCATCTGCACTGCGAGCAAAGAATCGGTCGCGTTGAATAGAGGGATGGTCTTCCGCTGGAGGTGTGGGTGGATACTGTGCGTATCGGCGA
CCGTCACTACTGTCCATGCCTTGAGCAGTGCCGAATGTTAATCGCCCCTCCGGCACCGGtgaagcaacagcagcagtagtagcGCGGTCATCCCTCACTG
CACTCGCCGTACTCACTGAACCCTGTCCACTACGACGAAGCGTGTCGAGAAGATAACGTTTGTACTTCTGGACCTCCCTCTCCTTATCCGCCGTGCACGT
GGTGCACGGACATCCGTTCGTGCAAAtcaagcagcgcagcaggCGTCGATTGGGTGCGGATCCGTTCCTGCCAACAAACAACGCTTCCATCCGCACTCTG
TAAACACTGCGCAGGTGTTCCCGACACAGCGAGTGGTTCTCATCTGCATGTGGGCAAAAGTTCACCACGGGCACAAAGTGCTTTTCCCTCACTCCACACA
AGTGGCACAGCCCTTTCGCGACAAAGTTCGCTTCTTGTTCCAAGATCAAGTCCTCCATTGCCACCGCAAACGCATCGTGCAGCACGGACTCGTCCAGATT
CACCTGCTCtctcagcatctcctccactCTCGGAGGCAGCTTCCTCTCTCTCTTGTAGTCCTCGGCCATCTTCCCGGAAGATCCCTCCACCTTCCTGCCC
TGGTACATATTTCCAGTAGAACGCTCTACCGCCCTACCTTGGTAGGGTGCAGGACCTTGAATGAGTCTCCCCTGCTGGTtacctgcagctccatccatcG
TTCTCCCTTGGaaacctgcagctccacccATCGTTCTCCCCTGATATCCTGCCGTCGGTGGATCCATCGTTCTACGCTGATAAGTGGTAGAACTGTCCAT
CGTTCTCCCCTGGTAGCCCGCCGCTCTATCCACAGCTCTCGCTGCGTAGCTCGCAGGTCCAGGAGGAACCATCATCCTCCCTTGGtaggctgcagctgcg
tccATGGGTCTCCCCTGGTGGTGGCCTGACGAGGAGCTCTCCGGTGCTCTCCCCTGGTACGAGGTATAACGCTCTACCGTTCTCCCCTGATACCCCGTAG
TAGCGTACTGTTGGTACTGCATCTGTTGCTGAGCCATCGACGCTTGAGGAGGTGCTGCGTGCGTCGGTCTCCCTCTCCCCTGCCAGGCCGCAGCCGACGG
CGTGGCAGTCGTCACACTGCTCGACGCGATGGCTGAGGCGgggatgtagccatctggCGTCTTGCCCTTGCTCATGATGGCTTCCATCCACACTTCGTTG
GGCGGGGGCGTAAGACGCTGTCGCTTCTTGTGAGGAGGAAGTGAATCAAGTcaaagagagagagaaaatAAGGTTAGAGAGGGGGGGAGGAGGGGGTGGG
GAGGGAGAACACTAAGGGCGGCACCTTGTCCCCGCGGTCCCGAGGCGCCCCGTGGTACATGCTGGACACCGCGTGCGCTCTCGCTTCAGGCTTGTCCTTG
TGCCTGCCCTGGCTGGGGGCTTCTTGAGATTTGGCGTTAGTACCACTGGGTGTTTTGGCGTGATTGTTGATGTGAGATTCGATGTATCGTGCAAAGAAAT
ATGGAAATGCTGGCAAGTATGAAATGATAGAGGTACCCATCTCACTTGGTGCCTGGATG