Description :
From Genome Similarity Track
Location :
Scaffold_5:187834- 191204
Transcript NameFunction/comments
Physo_510780putative tyrosine recombinase
Physo_303145Hypothetical protein

Sequence
3370 bases(100 bases per row)
AAAAACACTATTTGGATAGTTTATTTAGATTAATCTATACTCGGGGGCCCGAGTATAATTAACTCTATATTAAACTAAGCTATTCTTCCTCATACACGTG
CGCACACGTGTAAGCTGTTGCAGTGAGCCAAGGTAGGCCCACTACACTACTCCTAATTTAGGGGGCTGCTCGCACCCCCGGGCGGAATCGCACCGCGCGA
GCAAAAGAGCAGAATTCCGAGCTAAGGTTTACACGGCGATAAGGGCAAGTGCAAGAGCAATTCGACCGACAAGGCTCCAAGAACTGACCAAGGGTTCGTA
CGACACGGGTGTGAGCGTAATGTAGACAGTCACCTCGGAGGTTCGCGTCACATCGACCGCCTGCCTTCAACAATGTCCTCGCTAGTGAGGTTGAGGGTCA
CTTTCCAGGCTGTGTTTTCGCCGCTCACAGGATTTCACCCACGGCAGCTCGCCCTGGCAGTGGTCGGCATACTGGACGCTAAGCGGTGACGGAAGCTCGA
GGCACGCACGAGGCCACCTAGGCAACCTCCTGCACGTCGGATTGTCATGCGAGCCATGTACGTTGCGCTAGTACTCGTACTCTCTCACTGCTATGCGTTG
TTATCTTCCAAACTAGTCCATTCACATTGCACGCATTTATTTGGGGGTTGGCCTCGACGACCCGGCTCTCCGGTCGACGCTGTCATCCTGCAGTTTCGAC
GAGCTGACTCCTATCGACCTGGATCCCCGAGTCCAGCGTAACATCTGAATGGACTACTTTCTTGCCCCATGACATGTACGTGAAAGGAAATGATCGAAGT
GTTTTCTATAATTACATATCGTGGGCATGTTTTACAGGAGTACGATACCGTATATGAGCTCTCATAATTCAGAGCTTTCTCATAATTTATAGCGGAGAGA
TAGTGCAGTTTTGACAGAACATGGCCATTTTTGGCATGAAAATCCAAAAGTCAGCATAAAGGGGTGGAATGGTGCAAAACCAAAATACAACAACGCAACT
TAAAGGTTATGGGGTATGAATTGTGAGCGCTCATATACGGTAACAGTGAAGTGTGTGAGCCAACCGCGACTCGTTTTGTAAAAGCCCCACTACCTGTGAA
TGGTTCAAACCAGCGCGCTCGCATGCTTGGTTTCCTCCTTCGTACCATCACTGTAAGAAAGAGGGGCAAGTGGACTTGATTAGCCTTGAGGGTTAGCCTC
GATGGAGTCTCGCATATTTATCTATCCTACCACGGCACAAAACCTTATGAAAGGGGTAAAACCCGTCCTAACGCAGGACTCCTACGTAATTAATCAAGTC
CCTAAAAAAATTCTTCGCAGCGCTGGCTGCTCGGGGACTCTGAGCTCTCAGGGGAAGAAACGACGAGTGGCTGGCTGGCTCTTCGTTCTTCTCCGGTTCG
GAAACCCACGGTTCGGGCGTGTGGTTCACACCACTCGTACCTAACCGACCTCTTTCCTCCTTCGTGCCATCACTGTGCGAAAGATGGGCAAGTGGACTTC
AAAAGCCTTGAGGGTTAGCCTCGATGGAGCCTCCCCCCGAGTGGAGCAAGGGTGTTTCGCGACACTCCCATGACGAGGCCTTGATCACGCGTCTTGAACC
ATACCAGGTTTCAGCCGGGTATACACCGAGAAGCACCAACTTGAACATCGGTCCATCAGTCGGATCACTACATCACTCTTGCCGGCAGCAAGTAACGCAC
ATGCACCCCCAATCCGAAGCGAATGTGTTGAGTAGTCCTTTGAGGGAAGGCCTAGCCTCGCGCGGCGGCTTTGATGATGGTGGAAACGGGTGTCTTTTTA
ATGGTTTTCGTCCGTGATGCTGATGTTAGGAATGGCCCCAGCGACTTTCCCTCTCGAATCCATTGTTGTCGCGCACGTAGACACGCTGTTGCAGCTAGCA
CTGGGCATGTTTCGAACGGTAGTGACGGACTACCGTACCTTGGCCTATACGGTCACCTTTGTGTGACTCGAACATCACGTCCACGGAGTGCGCATCGTCG
GACTCTGGTCCGGTCTGTACCCCACGGCGATCTCGCAGAACCACGTTGGCTGCTTTTATTCAGTGCACACGGTCGCCGCTGCCGGAACGTGCTGTGGAAA
CCGGTCCCCATAGCTCCGAGCTACGGTCGAGAACGAAGAACCCCATCACAATCGAACCCCACACTAACCGAGACTCAAAACCTGCGATGTCTATCTGCTC
GTAGATTTTGAGCAGCATCTGTGTTGCTTCCGCTCCACTTGACGGTTGGTGCGCTTGTGTCCCTGAGCGATAAGGTCAAATTCCGGATCATGGTAGTTGA
GCCGGGCATTCGGAACTGCCTTGTGCGCGAAGACCACCGCTGCCATTTTTCCGTCAAAGGTCTGATACTTGTTGGCGATCTTACTCCGGTTGTGTCCTTC
GGAAGCACATTGTCCGGCAAACCGTCCCACCATCCGTGCTTGTTGTGCCCTGGGCAGCTCGTCGATCCAGACCGGGAATCCGAAGTCGGTGCAGAAAGAC
TCCCAGAACTTGAAATTCCTGGTGTACCTCCCCAGTGTCCCCTCGGTGACGCTCGCTCGTTTGAGCTGCTGCGTCTTTTGTTCAACTCTTCTGGTCCGCT
CGATATCTGTTCCAAATCGATACTATTAGTACTAATGTGCACGCATGACCGTCGCTGCACCATGCTTCGTGGAAGTAGGTGAGTGCAAACGTCGAGTCGA
AATTGGGCCTGGCCCAATGCACAACGGCGCAATTCGTCTTGTGCTTCTATATCGCTGCGGTTCATTCTACGAATGATACTTGCGACGTCTCCAGAATCTG
TGTGAATCCAAACTTGACGCCAGGCGCCGTTGATCGCCAGTTTGGGTCCCCAGCTCGTCATCACTCTTTCCCAGCATCGAGCAACCCTGGCATGGCCTTC
TGGATTGTCGAGGTGTTGAAATTCGACGCGTTCTCTGAGCTTCGTGCTCGTGATCATTACACTGCATCGATGGTTCTGTACTAGCCAGAGTTCGTCGTAG
CTGTGTCGAATAGGCGCATCGGCATGCCTCTAAACTCGTTCTGGAATACGAAGGAAAATTTAGCACCTGGTCCCGTGAGTTCCACCCAGTGGGAATTGAC
TGGGATATCCCAAGCGAAGTAGTATCGGTTCCTCAAAGGAAAACCGACAGGACCAAAGCAGTGGTTTCGAACCTGCTTGCCAAACGAGCGATCTCAAGGA
AGCAACTCGATTGTCTGGTGGGCGTGTTACGACACGTGATCAGCTTTATCCCGATTGCAAAAACCTTCTTTCAGAGGCTAGTAGCTGTTCAGAACAGCTT
GCGGAGACAACGGCAGTCAGTCGTGTCACTAACTGAGTTTCTCAAGAAGGACTTGGTCTGGTGGAGCGAG