Description :
From Genome Similarity Track
Location :
Scaffold_11:187809- 209796
Transcript NameFunction/comments
Phyke_g1526hypothetical protein PHYSODRAFT_248120
Phyke_g1527hypothetical protein PHYSODRAFT_309401
Phyke_g1528hypothetical protein PHYSODRAFT_309401
Phyke_g1529hypothetical protein PHYSODRAFT_343894
Phyke_g1530hypothetical protein
Phyke_g1531hypothetical protein PHYSODRAFT_316013
Phyke_g1532conserved hypothetical protein
Phyke_g1533conserved hypothetical protein
Phyke_g1534conserved hypothetical protein

Sequence
21987 bases(100 bases per row)
GGTCGATCATGGTGAATATTACGAAGAGActtggagaagttgaagcttGGTGGTTGCTGCGCAAATGGCAAAGTGAGATTGTCCGCAGAAGCTCGACTCC
TGTATTTTGGGGTGGAAATTTGTATCCGTACCATGTGCTTCAACGTCGGCATTGAAGGAGTCCTGCAGCAAATCATGTGGAGGGCTCGGGTCGGACAATG
TGCATTCACGTCAACACGCGGGAGTGGCCACGCACGAGAGTAGCACGTTGAGGCTGACAAGGGCCGCGTCAGCGCAGTATATACGGAGGATCACACCTCC
GTACGCTCGCTTTGCTTGGATCACACCGCTCGCTTTGTTTGCCCAGTTCGCTTTGTTCATCACTCTTTTGTTGTGTCAGGAATCCTGACCATGGACCATG
ACGTTGTCAACCGCTGGTATCGTTAGGACGTATGCCAATGGAGGAGAGAGGTTTACAAATACACTATATGTGTTGGCGGTATCCAAGCGACTGCGTTCGC
AAGACGCTTAATGTCATTAAAATTAAGAGTTCAATTCGCATTCTGGCATTGCAAGCATCTACTCAGCAGGAGCAAGACGTGCACTAGACAACACCGATTT
AACCACGAGAGAATGGCCGATCAACTCCCGATAGAGCTTGTAAGCCGGTCACCCCTGGCGTCATTGTATGATACCCAGCGTGGTTCCGCTTGACAATCTT
CTCTCGCACTCCCTTCGGCGCAGCAGGTGAACATAAtgtgttgttcttgatctgtGGCATGACATGCTTGAGGTAGTAGACACTACCGACCATGAAGACC
AGCACCGTTACCATAATGGACGCCAGGAACATGGTGTCGTTGAGACTGCTGTACAGAATCGCAAAAATGGCGACACCACAAAGCGCGATCCCAAGAACGG
CACCTGGGACACCGAACGGACTGCGGTACGGCCGAGAACGACCAGGCTGTCTCACTGCAAGGTAGATGTAGGACAGCAACTGGAAGATGTACGAGATCAA
CGCCCCAAGAAGTGTCAAGTTGATCAGTGCCGAGCCTAGATTGGCATCGCCGATGGTGTAgtgcagcaagatggcgatggcctCACACATGACGGTTCCA
AACACCAACGCCCCCACTGCCGTTCCTCGAGTCGGATGTTCGTAGGCGAGGAACTTGGGGAAGTATCCGTCCTTCGCGATGGCGAACAGTAATTGCCCCA
TGAAAAAAATGTATGAGTTGGGGCTGGAAGTCAGCGCAATGACGGTTAACCATTTGAGCACTGTCGTGATAGCACCATTGCCGAAAATCGTCTGGAAACT
CGTTACCAGCGGAGCCGACACGTCGGCCATAGCAGCAGCCCCCGGCGAAATCAACGAGCTGCATGTTGCCGTACCGAATGATAGGAAGACCAGGGTCACG
ATGCACAGGAGCAATCCACGAGGAAGGTTCTTCTCCGGTTCAATGGTTTCGTCGCTTGCCAGTGGGAGTTCCTCAATCCCCAAGTAGAACCACATGGCGA
ATGGAATGGCCCGAATGACATTATCCGTATTCGTGAACTCCCAATGCTGATCGACGACCCACTTATCGTAGTCGAGATACGGGATTGACACAACGAAGAA
AAATAACAGTAACCCTACACAGAGCGTCGTCGAACACGCCTGCATACGGAATGACGCCTGCACTCCGAAGATGTTCAAACTCAGAAAAATGACCCCAAAA
ATAATGAAGAAGACCGGCGCAAATTTTTCGTCGACGTTGAATAGTGCTTGGAGGTATGAGTAGACGGTGTAGAAGGTTGATGCATTGACTGCGATCACCT
TGAGAGTCTCTGCTAGACCACTGAAGAAAGCCGCCCGAGGTCCGATAGCATGTAATGCGAAGATGTAGGGTCCCCCTCCCGCTGGGATTGTCGCCGAAAG
CTCTGCGATCGAGAACGACAGCATCACGTAGAACACCGTCACAATGGACAGCACTACGAGCATCCCGTCGAACCCGGCGATAAGTGAGGACTGCCAGCCA
TAGTACTGGCCGCTGATCACTGCACCGATGCCCAACGCCCATAGTTGAGGGGCTCTCGCGTATCGGTGGGGCGCCTTCGACGAGGTATTTAGCAGATCAA
CTGAGACGTGACACATTTTGAACGCTTCCCGCTTGAAAAGTCTACTTTGAGATAACAGTCGAGTAAGGTATTCTTCAGCGATAATTTCGCAATGGACTGG
AGAGGTGGAATTGGAAGCCTGAGAACAATGCCATTGTGATGTGCGAGCGTTCGAGATCGACGTCTGCCTCCTATTGGCCGTACAGTATGCGTCACGGTGT
TCCAAACAGCAGGAACTTCAAGGCAACAAACAACAGCTAGCGTTAGCCAACAGCATCTTAGGGGAATACGATATCGAGCCAGCGATTCCGGCAAATTCTC
TATTGTTAACCCTTGGTGCGGGTTGTACTAATCTATCGACACCGGATGGCACACAGCAGGGATGGCTTGAGGTGCATCGGCGGAACCCTCGAGATATTAT
CCACTGATAGGGTTATCTCTCAGTGCAGTAGAGAAGGTGTTCTCACGGCGGCCTGTGATCATGCAGTAGAGTCAATGGGATTGCGTCCATGGTCACAGCA
CTATACACGCTGGCGCAAAAACGAATACTTCGTCTTGAAGAGTGCTTCCAAAACTGTAGCAAGGCAAAGTAAAGGCTATCATTAAAATGTTTATAAGGGA
TACAAAGGCCAAAGGAGTGGGTAATGCAAATAAGTACATTGAGCGGAACATGTAGATGTGGTACAGAAGAAATTGTTGGTGCCTCAGGGAATCTGTCCGC
TAGAGCTTGGGTACAGCACTTGACTCCGGGCGCTTAGCAGATTCTCGTTCATTTCCTTTATCGTGACAGGCGACCCGAGGGTTTTGTTCTCGATTTTCGG
CACGATGGTCTTGAGGAAGTAGATGCTACCGGCGATGAATACCAACGCCGTCACCACGATcgaggccaagaagatcgtGTCGGTGACACTCGTGTAGATA
ATGGCAAAAATGGAAACACCACAAAGCAGAAGACCCACGTAAGCCCCGAGCAGACCGAACGGACTACGGTACGGCCGAGGGCGGTTGGGCTGTCGGATCC
GCAGGAAAACAAACGACAGTAGCTGGAAAATGTACGAAATGAGCGCACCCAAAAGCGTTAGGTTGATCAGCACCGATCCTAAGTCATCGTCACCAATAGC
GTAGTGCAGGATCACAGCGACAAGCACACAACTGGCAGTGCCGAACAGCAGGGCGCCGGCTGCCGTGCCTCGAGTCGGGTGTTCGTAGGCGAGGAACTTG
GGGTAGTAGCCGTCCCTGGCGATGGCGAATAGTAACTGAcccatgaagaagacgtacGAGTTAGGACTTGAGCACAGCGCGATGACGGTCATCCATTTAA
AaaacgtcgtcgtcgccccAGCCCCGAAAATCGTTTGGAAGCTCGTAACGAGAGGAGCCGAGACGTCGgccatcgctgcagcaccaggcGCGATCATCGA
ACTGAACACCGCCGTACCGAACGACAGGATTATGAGCGTTACGATGCACATGAGCAGACCTCGCGGGATATTCTTCTCCGGTTCAATTGTTTCATCGCTG
GCAAGCGGGAGCTCTTCAATCCCCAGATAAAACCACATCGCGTACGGGATTGCCTCAATTGCGCTGCTCAGATCAGTGTACTCCCAGTCCTGTTGAACGA
CCCATTGGTTGTAATCGAGGTGGGGGATGGCGGAGAAAAACATaatgagcagcaacaatacGCAGAGCGTCGTAGAGCACGCCTGCATGCGGAACGATGC
TTGGACCCCGTAGATGTTGAGTCCACCAAAGATGATGCCGAACACGATGAAAAAGACGGGCGCGAATTTTGCGTCAACGTTGAACAGCGTCTGGAGATAC
GAGTAGATGGTGTAGAACGTAGACGAGTTGACAGCGATCACCTTGAGCGTCTCCGCAAGTCCGCTGAAAAACGCTGCCCGGGGCCCGATAGAGTGTAGCG
CGAATATGTACGGGCCTCCGCCTGCCGGGATCGTCGCCGAGAGCTCAGCgagagagaaggagagcaTCGTATAAAGCACCGTCATCATGGACAAGACAAT
GAGCATTCCATCAAAACCAGCGACGAGCGAAGACTGCCAGCCGTAGTATTGACCACTGATAACTGCACCAATGCCCAGCGCCCATAGCTGTAGTGCCTTG
GCGTGGCGATGAGGGGCATCGGCCTTGGGTTCTTGCACGTCAAGCGTTGCGCCACTAATTCGACTGAGTCGTGTCATCGTCGAGAGGTAGGTATGTTAAA
TGTtcagcgcctgcagcaaTTTGAGCGCAGCGAGGAGGTCAATTCAGGAATGGATAATTGAGCAGGACGGCAAGCATTCGGGTCTCCCAAGCATCCTACC
AACGCAAAACTGGCCGCTTGGATCCGACTGTTACTCAGGTGAAGGTGCATGGTCGCTAAAGAGACCTTGAAGATGGACATGCTATTGGCTCGGGTCAGCG
CGTCATGCGCCATATGACTTATACGAGCCCATTTAACACTACCGTGTGTGGAGACCGGTCGGCCATAACGTGGATCGGCGGCACAAGTTGCCGTGCGTTC
GGAGACGTCACTACCGGATGGTGTCCACTGGACGTGATGGGCGTTGATGCACTTCGCACGTTGAACACCTCTCTGAATGCGAGGATCCCTTGCCTACTAG
ACAATGCCTAGACACGGTCGTGATACTCAACTAGCATGTATTGCAAGTGCCTCTAATAACTGTAGGCCTGATGGCTATCCTGCGCCTTGAAGTGACTTGA
ACGTAGCATTGAAAAGTAGAAAGGACTCTTTCGAGCGAGTGAACAGCGTTGGCGGTCCGAATGCCCTCGGAGATGCCAGCGCACATCGCGACAGCCTCCC
ACTGCGAGCGTACGGAGTGCCCCATCATCTGCGAGCGTACGGGCGGTGCCAGTCGCGCTCAACCATGTCAAACGTCGATAACGCGTTGATCGGTATCTTC
AATAGCAAGCATAGACACGTTTAACACAGCCTTCAtgacagcttcaagctgccCTGTATGCTAGCGAAACGCCGCCTTCCTAGCTTGTGTATTGATCCAC
CTCATGCATGACGACCACCGCAACGTGACCCCTAGATAACGGCGATGAGACCCCCACGATGTAAACGAATCAAGCCGTTCGCATCGACCAAACAGCAAGA
TCCTACGCATCTCTCCAGTCGGAAATGATCCCCCATCTCAGCGATGCACCCATTTGTCCTTCAATTTGGAAGCAATCGGTACATGTTGTCCCACCCGTAG
GGCAATCTTGACGCTTACGTTACGATACCCCCCATCGTAACTTCGCGTAACATCAACTCATTCGCCGATCCTAACGACATCGCAAGATTAGACGCACCGC
GTTTGTACCGTGACCCGATGCGGTTCATGTGCCCTCCTGCCAATGGAAATGCAGTCTTGTTCAACATGTGGGCCGTCCTCTGTACCGCTGGCAGCGACCA
AGATGGCCTCCACAAACACCAGAACTTTGTTCACAGCTGCGAGTGGCTGCATGTTGCATGCTCTCTCTATCGGATACCCTGACATCGTTACCTTGGACCC
CGAATTTGGGCATCATCCGGCGGCATAGATCTGCATCTCCACATATTCCGCTCGCATGGAATGGTGGTTTCGAGACCAGCTTGCGGCGGTTCATGGTACA
ACATCTTGCCAGCTGGATGAAGCATGTGGAGCTTTCAATCATTCAACGGACATGAGCCTGAGCCTTTAGGTCTCTCACTTTTGGTTTTACCGCCTCCCCA
CCCCACCTTCCAGAGAAAACGACGCCATCATGGCTCCAAGTGTTGACATTCCGTACAGTACCAAGGAAATCAAGCACCCACTTGATCCGGTCACGGCGGA
CGAGGTCCGCACGGTCAAACAAGTGCTGGCCGATGCCGGGTACTCGAGTCCGGAACTCCGCTACGCGTACGTGATGTTGTTCGAACCAGATCACGCTACG
CTGGCTAAATTCGAGGCTGATCAGCTGCCAGTGATCCCACGTGAGATTGGTGTCTTGGTGCTCGACCAAGAGACAAACGTCACGCACGACTTCGTAGTGG
ACGTTGTGAACCGTTGCATCGTCAAGGAGGTCGAGCTGGACCCAAAGACCGACGGACAGATTCCGATCCTGGACCAAGACTACTGGGATGGAGATGCCAT
CTGTAAAGCCGACCCGGCCTACGTCGCTGCGCTGGCCAAGCGCGGCATCACCGATCTCGACAAAGTGCGCGGCGAACAGTTTTCGGCTGGCGTTTATGGC
TACGAAGGCGAGGAGGGCAACCGTATGATTCGTGTGCTGAGCTTCCTCAAGGCTGAAAACACGCACTCCATGTACGCACACCCGATTGACGGGCTTGTGG
CGCACGTGGATCTTACGAAccgcaagctgctcaagctcgtCGACACGGGCTACACTCACATCCCGATGGAATCGGGCGACTACTTGGACCCTAAGATTAC
CGGCCCCATGCGCACCGAcatgaagccattgcacaTCAAGCAACCCGAAGGCGCAAGTTTTACAGTCAAGGACAATATCGTGTCGTGGCAAAACTGGGAG
ATCCGCGTCGGCTTCAACGGCCGCGAAGGACTGACGCTCCATGACATTTCGTTTAACGACCGTGGacgcaagcgcaagatccTGAACCGTGCATCGGTCT
CAGAAATGGTGGTGCCCTACGGTGAGCCGCAGCCCACACACGACTGGCAGAACTATTTTGACGCTGGCGAGTACCAGTTCGGTCGCCTTGCAAACTCGCT
TGTGCTAGGGTGTGACTGCCTCGGTAAGATCCAGTATCTGGACGCGACTGTCGTGGATGACTTCTGCGAGCCATTCGTGATTAAAAATGCTATCTGCATG
CACGAAGAGGACTATGGCACTCTTTGGAAGCACACGGATGTCCTAGTGACACCAAACACAGGTGCAGTACGTCGTCAACGCCGGTTTGTCGTATCTTTCT
TCGTGACAGTCGGCAACTACGACTACGGCTTTTACTGGTACTTTTACCTGGACGGAAGGATCGAACTGGAGTGTAAGGCTACTGGCATCGTATTCACGTC
CGGTCGACCTGAAGGCGAGTACGAGTACGCTACAGAGATGGCGCCTCGCCTTGGTGCACCGTGCCATCAGCACCTGTTCTCTGCCCGTCTGGACGTGGCG
ATCGACGGCAATAAATGCCATGTTGACGAGTTGGAGGCTAAGCGCCTACCAATTAGCCCTGAAAACCCACACGGCAATGCGTTCATCCGCACCGCAACTC
GTCTCAAAACGGAGAGCGATGCCCAGCGtgtggcagcaatggacaAGGGGCGTGTATGGAGGATCGCATCCAGTGAGGCGAAGAACCGACTTGGCCGCTC
TACGGGCTACGCTCTCTTCCCGGAGGGCCAACCGGTGCTCCTTGCAGCAGACGGATCGTCCATCTGGAAACGTGCCAACTTTTCCACCAAGCACCTGTGG
GTCACTAAGTACGCCAGGGACGAGATGTGGGCAGCCGGTTACACGCCCAACCAACACCCTGGCTTTGCTGGTCTGCCTTCGTACGTGAAGGGCAACCGCC
CGGTGGATGGCGAAGACATTGTCGTGTGGCACACGTTTGGCCTTACACACTTCCCTCGTGTTGAGGATTGGCCCATGATGCCTGTGGACTACGCGGGCTT
CAAGATGGTGCCCGAAGGATTCTTTGATCGCAACCCGACACTTGATGTCCCTGAAGACCCCAATGGTAAAGACAGCTCCGACCTGAACGGATGCTGCAAA
CCGTAACAAGGGATTAAGACAACAACTATCCTGAGGCGCAGACGAAAAGTGTTCAATGACTATGATCAATGCAAAGTATTTCCTTGTAAAAAATCCATCG
ATTTCATCAGCAGTGCAATCGTGTCGTCTACAGCCTCTTCTTCAAACGGCAAGACCATGTTTGTTGTACACGATACCTGTTGTAGAAATTAATTTGAAAT
TAGTTTATGACAGTTACAATTGTAATTATGTTTTAGAGTTTAGTAGTTAACAATATATTGTTAATTAGTCATTATGTGTTGCACGATGTTGCACGAAGCC
GAACCAGAAATGAACTTGTTTTCATTATGACATAGAAACCTCTATATTAGTGATTAATCAAATCGCTATTTCGCTCATCAAAGCACGCGCCAGTAGGTAG
GGCGTAcaaccttcttcttccgcCGCGCAAGAAGCCCAGCCAGAGCCCCACACGCGCGATGCTCACGTCTGCCAAGTCTATGGACGATGAGGCTGCTCGA
CTGGCGGTTCTGAAAGACCCGAAACGTATGGCTTCGTTGCTGGTACGCGCCTTCTCATCCTCCATTTTAGAAGCGAATGGCGACTCTGCTACAAGACAAG
CAaggcaggaagaagaagacgacgaagaagtggaggagaCACAAGAAGAGTTCGAAGAgttggaggaagaagcgcagaGAGAGAGCGAGAACGCTGCAGA
TGGTACTCTACGAGTGGTCATTcatcctgctgctgtagaagacgaagacgacgctgatgaagaggaagaagaggctgaagaagaggctgaagaggaagaa
ctGAGAGAAGACCGACcactggatgaagaggagctggaggcagcagctacagctcTACAGGCTGCCACGCGCATCGTAGAAGAATTGCggctgaaaatgc
tgctgaaAGCAGGCCAGAACGTCGAGAAACAGCCCCAGGAAGAGACGGAATCACCATTTTTATCAACAGGTTCAGCAGCGATAATGCCACCTCAATTTCC
ACGATCAGAGAGCAGTATTTCGACGGGGGGACCTGGAACTCCTGTGCCACATGCACGAGTACGGTCCAATTCATCCTGTCCGACGTGCAGTAAGTCATTT
AACGCCTTCCATCGCAGTAAGAACTGCGCTGCTTGTGGGTTTTCTTTTTGTCCCAAGTGCTCGTCGAAGAACGTTGTGCTACCCAGTTGTTATGGACACC
GAGACGAATCGGTACGTGCATGCGATCACTGTGCAAGGTGGTTCCAAAAAGCGTTGGACCAATACTTTGACGCGATGAACTTGTCCAAGACAAGGGATGA
CGAGCGTGCAATTCATCGCAGGAGTAAGGGAAACATTACGATAGAGGAGAAACCATATCCTCAACccaccatcaacagcatcacagTGCCCGCTTCAACT
ACCAGTGACGGAACACTCTCGATCATGACTCGCCGACACTCATCTATGTCTTCCCCAGAGACTGCGTCCAGTTGTCCTAATGATGAAAGTGCTGAcgatg
tggatgaagctggAGATAATGCTGACCAGCAAAACGTTTcatcttccacttcagcatCTAGGCGACGCCGTCGCCATGCATCCATAAGTTCTGTCCCGTC
TCCGTCGACGAATAAAACCAAACCGTGGTTTAGTGGACATTTGCGTGCAATGCACGTGAATGATAGGCTGCctcggaagaagaaggtgacaaGTGAGGGC
GATGGTGACGGCAATACAAGCAGCCCGGAGCTTAGATTATCTAACTCGCGGAGGGGTAGGCTAGGTAGCGTCACATCAACACCGTTTAAGAGCGGACGCA
AGAATGAAGCAGGTGAACCGCATGGGTCCAACGTCCATAATGGAAATGGTCGATTACGTCCCGACAGTGGAGAAAACAAGTTGGACGCCGCGACAAGCGC
CATTGGTACGCAAGGCGGGTCATCATTACAGATGTCGATAACTACGCCTGCCAATGGGAGCGAATCTTCCATTCGACCTCTATCTCAACGAAAGTCGCGG
AGATCAAAGTTTTCACGATCAGCCAGCTTTGATTTTACAAACCTGCAGTCTGCTTCAGCGTCTCCTGGATCATCGTTGGGGTCTCCAGATATAAAGAGAT
GCAACACATTTGGACCGGATGAAACAAGTGGCATCTCAGATGATGGTGCAAGTAGTGGCAGTTGTCGCTCGAACAGTATGCGAGCGAAGAAAGCGTTTGA
CGACAGTGACATTGTGGATGCGCGAGCGCAGCCTGACTCGGCTGATGTGGAGTTGAAAAATGAGGCGAAACTTTCTGCCGCTGTGTTGCATTTTGCAGTA
TATGAAATGGGTGGGAAAGAAAACGTGGGCCTGCGCCGCACATTTGGGTTTACGAAGGCAAATCCAGTGCTAGACCGGTATACCCTGGAGCTTGATTGCC
GGCAGCGCATCGTGCGTGCAAAATCTGTGTTCATGCATCGCTTTTGGTCATTTCATTGCGATTCCGTCCAATCTTTCTTGTTTGGGTCATCCGAAGGATT
GGCAAGTCTCGTGATATTCAATGGTGGGCAAGGAAACCAGTCTCTAGAATTGAAGTTTGCTAATGATGAAGAGCGGGAGCAGTTCAAGCAGGCAATAGAT
AGTTGTCGATCAACCAACTTGCATCGAATGCGTAGGTTTGCTTCGCGAGCTGCCATGTCCCTTCCAGCTCGACCAGAACACCCAGTATCTCCTGTTCTGG
ATAGTGTACGGTCGCCCACGTCCCAAGAGCCGAGCACAAGTTTTTCAGGCGATGCATCAACATCGACCGCGTCAGAGTTAGGATCGAATCGTGATATTGT
CGACGGTAACTCCGTTGATTCCCCAATTCAGCAATCGATTCATGTCCCGCTGTTGCCTGGAGAAGTGATAGCCAAAAACACCGAGCTGCCAGCAACACTG
CTAATCGGGCCTGCAAGCGAAACATATGAATCTACCCAATTGTGGGGGCGAATTCGTGGAAAGGTAGCGGTGACGAACTACCGTGTGATGTTTATACCGT
TCGACCGGGTGCAACGGCAGCCACGATCAGGCGGACAGGGTGGTATTGCGTATGTTCCGCTGTTTGCTATCGTGCAAGTGCAATTACTATATCCTGGTGG
CCGTCGAACAAAATCAGGACGCACGTATTACGCTGGGATGGCAGGCTCTGCATCTATTATCTCCATCAGCTGCAAGGATATTCGTGTCCTGAGATTCCAA
TTAGACGCTCACCCGGATGACCACTCGCAGAAGCTGCGAACTACAATCGCAAAAATGGCCGACGCTTCCCAACGATATTCTATCGTCGAACGAAGGAGGA
CAGTTTCTCCCGGCCTCGGTCCGATACTGAGCACACccgacagcagcgagtcACCAACAGATGGAGAGAGTCGAGGCGACGATTCCGACTTGCAAGATAG
CAAAGAAGCTGCCTTACATTCCATCCACTTGAGTCTCAGCAGCTCTCGGAGCCCAGTCACTGCGCAATCACCGGTGCTTCGCCCAGATCGAATGTTGATG
CTTCCTCATGAAGTGAGCGGCTCATTTGCGTTTTCATATTCGATCGATGATGTCCCTATCGATCAAAATGGATGGAAGCTGTTCGTCGACGACCGTGAAT
TCAAACGGCAAATAGGAGGTGATCCTTCAGTTTCACCATTCCTCAAGGTACGAAAAGAATCACTTGCAGTGGTCTGTTTACCTATCACGCTTGCTAATAA
TGCTTTTATCGTGCCATGATACAGTTCTACAACAATAGCAAAGGAAATATCTGCAAATCATACCCATCGAAGTTGCTCCTTCCAGCGTCCATGACTTCTG
CTACGGTGGGCAAAGTGGCTGATTTCCGTGCTAAGGGTCGACTACCAGTGATCACGTATTACCACCGGCGCAACCGTTGTGTGCTGGCTCGATCTAGCCA
ACCCTTGCTGGGGAATTTGCTATCTGGTACTTCGAATGTTTCCGACCAACTTCTTGTGGGTGTGTATCGTCGACTGCCAGATATTATCAAGAACCAATCC
CAATCGTCGGCATCATCTCGACCGATCTACATATTTGATGCTCGTAAACCGAAAGCCTCCACGGGCAACCGTCTTATGGGAAAAGGAGGAGTGGAGACAC
CCCAGGACTACCCGGGCGCTGTTATCCATCACTTGAACATTGCGAACATGTATCGCATGCAGTCTTCATTCATGGGTCTAATGAAGCTATTTCTCCCTGG
CGGTGTCGAGGATTCCGACAAGACGTGGCTATCCAGTGTGGAGTCCACACGGTGGTTAGAGCACGTACGACTAGTGCTAGACGGGGCTCTGAAGATTGCA
CGTGTGCTGGAGTTAGAAGGGGCTTCCGCTCTTGTTCATTGTAGTGATGGTTGGGACCGAACATCGCAGCTGTGTGCTCTAGCGCAGCTAATGGTTGATC
CGTACTACCGCACGATTCGAGGATTTGCAGTTTTGGTTGAAAAGGACTGGTGCGCCTTTGGACATAAGTTTAGCGAGCGCACGGGAGGTGACCGCAATCG
TGATCCGCAGCGCAACAAGAGCTCGCCGATTATGTTCCAGTTTATCGACGCCGTGTGGCAGTTGCAGCGACAGTATCCTCACTCTTTTGAATTCAACGAG
CGCTTTCTGTTACACCTGGCAAACTCGATGACGTCAGGGCTCTATGGCACATTCCTGCATGACTCGCGGCTTCAACGGGACGTCAGTGATGTGGAGGACA
ACAGCGTGTCTGTTTGGACACCCATACTGTTGAGACCGTCACTATTCTCGAACACCAACTACGAGATTCATGACGGCCCCATTTGGCCTTGGTCGAGCAA
CAAAATGATTCGTATCTGGGACAATTACTTCTTCCAGTGGCACCCTAAGTTTTACAAGTGCCAGTGGGCCTGTAGTTTGGCATACCACGGCCCTTCCAAT
TCGGGTGGCAGCATAAGCAATAATGCTGGAATTGCCGATAACAACACGGAGGGTGATGAACAGCAGAGGGCGCAACAACTTGAAGGTGCGCGGATTAGAG
AATCGCTAGACTTGTTGGCCACCCCTATTACTTCTACCATCACCGAGGAtgatggtgaagatgaagtaCCTACAATGAATCTCTCctcggacgatgaaga
caccAGCAGATCTATACGAACCCGCACCTCCAGTGGCTCATACCTTCAGAACATCTTTGGTCTTGGCCGAGGAAGCCGACAACTATCGAAAAGCGCTGAC
GATAATGACGGACTTGAAACGTGGTAGAGGCGATGACCAATGGAGCACGGAATACGATCAGGCACTGCGCCAGCGTGGGGATTGACGCCCAACATACGTG
AATGCTTCTCGTGTAGCAAATTGACTACTTTTACATCTTTATTCCTCACTAAAAGACGAGCGTCGGGGTCAGTTTACAGCCCCACAGGAGATTCTTCGGG
ACGCGTGTCAATGACGATAGTACCAGGCCCTGCAGTACCACAAAGCCGTGATCCGTACACTTTTGAAACTACGCCGCAAATATCACCTTGTGCCCCCAGC
TCATTGACTTGCTGACCGACGCTGTACTTGGAGACCTCACTGCTGTTCAACTCGATGAAGCGCTCGACGACCACAGCTTGTTGTATGAACTCTGGATCAT
TACCCAGCTTCTCGAAAACCTCAACGGCATCTTCAATGGTCTCGGTCACGAACGATGGTGGAGTTTCTCGGAAGAAGATATACTCTTTCGTAGGCGTACT
ACCAGCATTCCCCAGCTGCACATGTTTCGGAGCCGTCCTCAAAGCACGCTTTCGGATAGCGTATTCCGAAAAATGCCCAGTGTCGTGGCCAACATCACTA
CCAGTATTTTTTGGGTTGTCAGACGTAGCCTTGCTCGACACATTTGTGCtatcagcttcttcttcatcatcatcaccatcatcatcgatATCCTCAAAGC
CTAGTGCGCGTAAGTCTTTTGCACGAGCCAGTGGAGTCGATCCTGGATCGCCGAAGACAATCTCGTGTGCTTGAGGCTTTGGCGTGGAACCAGGATGATT
GAGGCGATTATAACCGCTTTCTGTTGCGTCTTTTACCACAGCATCAGTTCCAATATTGCTGACATCCTGACccaagttgctggtgatcACATTAAGCACA
GGTTTTTTTCGGTGACTACCGGCAGTCGATTCTGCCTTTACACGAGTCTTCCTCTCTGCTGAAACGGATCGCTCCTGAACACGATTTTGACACAACACAA
GGTGAAAATGCACAATATGATGTAAGGACAACGGAAGGCAGATTGAAACCTGACCACGCCTTGAACCCGCACCTTTGTAGCTCGTTTTGCTTTTGTTCCC
AGCTTGGTTTGATTCGATCGCACTAAGAAGCATTCCAGCAACGAGGGATTTTCAGATGGATTTGTGCTTTCTTCTGTGCCGGTCAAGCATCGACGCAATT
GCTTGGTCTCCTTGATACTAAGAAGTGGCATCGGCTGAAAAGAGGTGACGGAAGTCGAGTTAGTGATTTTTCACGTGCCAACTCTACCATGGTCAACTTA
CTCGCTCTTTGTCCAATATCTTCACAATGTCGCCATGGTTGTGCAAGAGTAGAAATTCCCGCACGAGGTGATGTACGCCGTTGTCCAGCGTCTGCTTGGC
AGTTCCACCTTGTTTCTTCCCATTTTGCTGTCGCCGCTCTTCGCTAGAGAGAGATGGTTGAGACGATCCCGTGACATCACTTCCAGTGCTGACAGCTTCG
ACAATGTCAGCCGATATGATCTCATTGGTCTTGCGATTCGTCGATTCGATGATACCCGACAAACGCGGAGTGCCGACGTTGGAAGCTTTACGGGGgtcat
cattgtcgtcatcaCTATCGTGATCTTCTACCACGACCTCAACCTTTCCACGTTGTTGTTTCCTCCGTTGCGATGACGCATCACCCCCCCAACCACCTGA
CGAAGATGCAACCCCCACATCGTCGGCGAAggtcgtcttcttccgtcgTGGTTGCGATGCTACCGACTCATCGTTCAAAGCCCACAGGTTCATGGTCCGT
GatcaacaccaagcaaatTCGAAGATGCAGACTTCGTCAGGGCTTTCTTATCCCCGCTGGCGGCATTGGCATATTCTTAGACTTCTCAACCAATTGAGGT
TTCAACATATAGTGGGTGATTTGGTGTGAAAGCACCCGTGGATGAGTTTTGGCGCGTGAAACGTTTATTTAATGAACAACCTCTAAAGCTGTATTCTTCC
TATCCATCATCTTTACCGTAACATCTTTACTGTAAGCTGTAAAGCAGACGCTTTGATCACCAGGAAACCTATAGAAAGTTAATGAGGTTCTTAGCGTGAG
AGAATATCTACTACGAATATTTGCAACCGTCTTACGTTAAGGCACACAATGTTGAAGTGTAGCCATCGTCGTTTGCTTGTACATGTTGATGTTCGAAAGC
GTTGCCAAATATTGGTGTATCACCATCGTTGCATGAGTAAATTTGGTGCAAAATGAAGTAGATTTCACAAGCCTGGTGACCAGTTGATACAGGCTTAGCT
ACAGATCTGTGCTGATGCTGGGGAGATGTATCACTATTTTACTACGCAGCCATGAAATAATGTTGCAGACATGAGCGCATCAAGGTTGAATTTGCAATCG
ATCAGCACACCTCTCAAAGCGGACAGGATGTAGCAAGGTGTTCGGAATGTTCAGCATGATGAGGGGCAGGATACTATTGTCGCATCACACCGAAGAGGAT
TCCCCCTAGTGCTTGCGACCGtcttgctggagcttgaCGTTGTCTGTGAATCTCATAACTAGCTGCGTGTCgccattttttttgctgcagatTTGTTGCT
CGCTGCGCATCTTGCTCCATgcaagctgccatcatcacATGGCTAAATGCGATGCGCTGTCCACCATCATGTATACACGAGCGAGTTCCCGTCTTATTGC
TGGAATTGTGCGGGTAGAGACCATTTTCGACTGATGTTGGGTTCTATCATAGCAAACGGCAATTATTCATGACTGGCGGTGGAGTATCTTGCCTTCTTAT
GTACGCTTTAAAAGCTGCACTGTGGTAACATGTTACACATGGGGTAGGTCTTTGCTACTGAAACATGAGAACATGTATCGTAGTCTGCGGTGACGACATA
AGGATCTTTTGGTTTCGAGGAATGACTGGAGCCAAACTCAACACCATGGTCTGTATGTGACGTATGATACACCGAGCTGTCTGACGCAAGGTTGTCATCC
CTTTATCAATCTCACAATGGATGGCCGCtgttgacgagtttgggAAACAGACATATTAGCCATCTTGAGCTGCCTTTGCTGCGCACACGAGGTTCCCGCG
GGGCTGCCGAGACTTCCCGTCGCCCCAGCGACATGCCCAGCGCAAGAGAAGCAGACGTTGAGTCTGGCCTACTCGCTGTCGCCGAGTAGCTCGCCGCGTT
AGCACACAATTGACGACAACGGCGGCTTTCATGCGACTTTAATCGCAGGGGCACAGACCTGGGGTTCTCCGGTTTACAAAGGAGTGTACAGTGTACCGAC
CAGAGTAGTGAAGATAGCGGCGAGATGGTGGCTCTGATCCGTCCCGCAGTCGCCTACCCTCTTGCTCCGCCCCGCAGATCTCTCGGAAAAGTAGTGTTCG
CcggctgcagctgcagaaagGATGCTTTTCGAACTAAGTTGGCTACGAGGCAATGGCTAAGCATGTTCACGACGTTAACAAATTTGTCTTCGGTGATCGA
AAGCCGTCGCCGCATCGCCAGCATTGAGCATGAAGAGCAGGTGAAGAGTTTTCCCGCAACCGAATCAaaaaactggagcagagacACAAAACAAGCCACT
TGAATCCCGGCTCATCTTCGGACAGCTCTTCAGTGGCGGACTCTTTACTGGCCAAAGAAATTATTTAGCTATTTGCGCACACGTGTGTGGAAGCAGCATC
CAAGCAACGAACCTAAGAGCCCGAACACACATCGTTCTTCCATTCTCATCGAAGAAAGTGGCTATGCTCAATCGCATTGACCAAGACAGCGCGAAAATGA
CCAGCGCCAAATGCATTCCTACCCGATGGGTTATGTGAAATCCCCAATTATGTATATGCGGAAGCATACGGATCTTTAGATTTAAAATTTGCAATCCTTC
CGGAACAACCATTTGTTTTTTCGGAGGTATCATGATTTCAGGACATTACCATTCGGTCCGCGTACGGTTTGACTTTGATATGCAGGCTCGACCACCTAGA
AGCTCCAGTTGCGAGAGAGGATCAGGGCTCAGCTcgtgtttttgctgttcatgACAGCACTGTCCAAATTCGGTGTTCACCATAGACAGCTGTCCTTTTG
ATGCTCAAAGAGCCTGTACCCAGACTAGGACAAGGGATCGGTTCATGGAGCAGATGGTATAGTGACGCAGCCTGCCACTACTCTGTGAGCTGAGCTCGCA
GTGAATTCAATCGCTTACCCGCTTTACTTCACCTCACTCTTGGATTTGCCGTCTGTCGCTCAAGTGCCTTTGAAACTCTCCTTACGATCATCACAATGGA
CGCGTGCCTGCAAAAGTTTGAGACCACCATGGGCTCCACCCCGACCAAGTCCTCGACCGAGGAAGTGGCAGTTTCCACGCCTCGTCGTCTCGCACACTGG
GACAGCAAGCGGGAGAAGTGCGCCAATTGCGAGCTCATCTACCTCAAGACGCTGAGTCAGCACTTGGGCTTCTGCTCCGTGGACTGTAAGTCCAACATGA
CGTACTTGGAAAAGGTGAACCGCACCATCCGCGCCATGAAGGACGCGGTTGATGAGcgtcaacaacaccaagagcaagcagctcgCGCCGAACCGGCTGC
TTACCAAGAGCTGCACCAGGTCGAGGAGCCAATTGCCAAGCAACCACGCGAGGCATCTCCCAAAGTTGACTGTGCTGCCCCAGAAACTGGTCGCAGTCTG
AAGGAATCGCAATCGTTTGCGGAATTCGGACGCGAGTTGCGAATTGTGGACACTACCAACGTAGAATGGTCTTTCAGCGCCGTGTACTAAAGATCCTAGA
GCCGATTGTAAAACTAGAGCCTCACGATAGAGAATTTGAACGTGAGATGTGTATAAGCGCATTAAACCGGCATATAATAGAGCACCACATAGAGATCAAT
CTTGCAGTCACTTAGTTATCTTCCTAGCATGACGAAGCGATACGAAGCACGCAGTATGTCTGTATTTCCAAAAGCTCATACATGTagttgtcgctgtcgc
taATGCTTTTAACTTTAAGCACTGGTTCAGCGCTGCATTTGGGCTGAGATGTTCAATTGCAATGCATTGCGTAGCATTACCCAGTCGAGTCAATTGGTAT
GTAGAACAGCAAGCTTACTTGTACAGGCATTATTATCCATGGTGGTTGAAATGCCAGTTGGTGCGATGCTGCTCTGTGTTTGTCAAGCAGTTCGTGAGCA
GGGCGTTTGACTGACACGTGGATGCCTTTCCACGTGGCTCCAAATGGCATGGAAGTGAGTTGCTCGCTTCGCCATGTAACAAAGGGTTAAGTATCGAACA
AGCGTAACAACGTCGACGTAGCGAAAGATGCCAAGTGTCGGATGGGCGAGGTGAAATGATGCCCAGCCCATGCTCAAATTCACATGTAAGCGGATAATGC
CATCCTGGTGCTGCACCGATTTTTGAACTGAAGGGCTGCAAAAATGCTGTTGACGCTGCAAGTGATGGGTTGCTGCCGGACCTGAGTTTGCACAGCGGCG
CCGTATCGTCCTCTTTCTTGCCACACCGCGCAAATCAACGCGGAGCGCGCGCTCGGTTTGCGCGCCACCAGCTGTATCCATGCGGAATGGACCTGACGAG
GCTTGGCTCGGATGAGTGTGTTCATAAGAGCGAGCAAACCGAGACAAACAAGATGAGACGCTCAACGTCCGATCGCGCCGAGACACCACCGAGCTCCTCA
CACTTGCTTGCTCGCTGATTCAATTCGGCTTCACGGTAAGAAACCAGCACGCCAAGTGGTAAAAGTGAGATCGACAGCAAACTCTTTCATCTTCGACGTC
GGTAATGCCCTTCACAACGCATCGACAATGCGTTCGCGCCCGTTCGCTACTCCCAGAATGCTTCAGCCAAGACTCTTGACCGAGGCGCTGGCCCAAGAGA
ACCTGCGCTCCAGTGCCGCGGCCCGCGGGGCGTGCTGGGCCAGTCCATCGGTGCCCGGCGCACCTGACGGCAGACAGGCCGTGGAGTCGTGACTGGagcg
ctgcaactgcagcttccgccCTCACCAGCGACAGAAGAGCCTGGCATGAAGGTCTCTACCCTTCCACCCTTCCACCCTTCCACTGGAAGGGGAGGGACCT
TCGGAGGTTCCAGAGCGTAGCTGTCTTTCCCGAACGCCGGCTGCGCTCGTCAGAGCAGAGGCGAGGCGTCAGCCaggctgaagaagcggcATCATGACGC
CGGCATGGAGGAGAGGGGCGTTTGACACCGGGATTGACAAAGGAAGTGGGGGTGGTGGTGTGACGTCCACGATGCCCCGACACCTATTTGGCGATCAAAC
GCAAGCACTTGCTATGCGGGCGTACGAAACCTAGTCTGTAAGTGCATCAGGCTAAGTAATATACATGTGATCCACTCGATGCTCAAATGGTTGCATGGTC
CCGCGTGCTTTTGCTGCGGTGGTGCTTGTGTTGCCTATCTATCGATGTCTGTTGCCGCGTTGGCCTTGCAAGCAAAATTCCTCCCCAATCCTGGGTACGG
CGGAGCGATCAACTTGCTTACTAAAGGTGCCCTCGTTGATCGAGCAGCGGCCGATTCGAAGGCGTATTACCGGTATAAAGGTTGCCATCCCTTGGCACCT
GGAGTCACCATCTAAAGTTTTTCACGACACAGCCTTGGGATCCGTGCTCAATGACGTCGCttctgctgtcgctgctggtgccagtGCCGGTGCCGGTGCC
GAGGGACAGGAACTGGAAAACCTCTTACAGCACGTTCGCTGGCAAGCGTAATAGAAGGTCTGTAAGAACCGATCGTTAGCTCGGcactgttgttgttgaa
gcgcTCTCAGGAAAGATGAGCCAAGGAACGCGTTCTTCCTGTAGACGACAATCGTCGCCAGATTGCTACGTACCGGTACCGGTGTACAGTACCTGTCTTG
ACGCTTGTAGTCATCTCTGCACTAATGCATTCGTCAGTCAACCTGACGCAGatttctgcagcttcgtATCGAGACACCATGCTAATCTTGACTGTTAAAA
TGCCTCAGCGAAATAAATTGCCACGAAAATATTAATACGTGTATGGATATCCTAGCAGCGCTTCCCACGCGTCCCATTGACACGCAAAGTATTTGACAGC
ATTCCCAGTCCTCTTTTACTCCAATCACCGTGCACCGAACACAAGTGAGACTGACGTCGTCTCGGTCAAGACCTTTTGTCATCCTCGCACCCGGAACTCG
AAGCCCCCCCTCAAGCCTCCGACAGCCCCCCGCACCTGATAAAGCATGAGTCGTTCCCGCCAAGTTGTGGTCGATGACCAAGTCACCGAGTTCTGGAATA
AAAATGCAGACTCGACCTTCGAATTGGGATTGTTGGTGGGTCAAGTGAGCCCCTCGAACGTTGGAGACTCTGTACTGGCGGCAGTGCCGGTTCCACCCGA
AAATGAGAGAGGAGAAACCCCCAACGGGCTCGCCGATGTATCAGTTGAGTGGGTGCAAGAGGTGGCACAACAGGTAGATCGACTACTGCCTGGGGGCATC
GCCGTTTTGGGTCTCTACGTGATTTCGGCTCGGGATGTGGCGACTCGAGCTGTGCCGTACCTCCGTGCCACAGCTGAGGCAGCCGCGCTACTTTCCGGCA
CCCAAGGAACTGATGAAGTGCACTACCTGGCAGTCGTTGCACCTAATAGTGACGTTGCGTTCCAGAGCTTTTACAATGTCATGGATGTCAATAAGACGCA
GATGCTGTCGGCAGAGTGCAAGACGCCGACGAAGGGTGTCCAGTTCAAGCAGTACCAGACGCTGATTGACCTTGATGAACCAACGCCGTTTGTTAATGTA
TCTCCGACTGCGACATTGGCAACGACAGAAATGGCTGCTCAACGCATGGAtgaggtggagaagcagatgcagccgCTTTTCCGTCGAGTGAAAGCCGCGA
TGGCAGTGCCCAAGACGACGGGTGACCCAGTGGTTCAACACATGAACCTCATGACGTTGACCCCGCCTGAACCCCACAAGACCGTTGAAGATGTAAGTCT
GTATCGGTTAAGAGGTTTGAACCTGCTGAAATGTACTAACCGATTCGTTGTTCATGATATTTTACTCGATTAGCCTCTTGGTGGTGTGCACGGCGCGATT
AGCTGCGTCGCGTATGTGTCGCAAAGTGAACCTGAGGCACACGAGGTTGCAGCCAATTACCTGAAGCGCGACTTTGTCAAGTCGGTTCTGGTGCGTGTAG
AGCTGGCCCGTGAGCGGTGggcagatgacgacgaaggtAAGGAATAAAAGCGCTCTCATGCTTTACTATGGCAGAAAAATTGGTGACCTCATAGCTGACC
ATTTTTATCGATTTTGTGTAGTCGAACCGAACGACGTCTTTAAAGAAGGTGGCGTATTGCGTCTTGCTCAGCGAGGCTTGGTGCCGTGGCGCTCTGCTGC
CATGTTAAGCCGACACTTTTCCGCTACTATCCACGTGTTTCccgatgaagatgtggatCAAGCCGTGAAAAATGCGCTTGAGATTTTCGGCAGCGATGTC
AGTCATGACACAACCGTTTGGAATGCCATGGAGATCGGGGGTCAACTAGACGGCCCTCCAGATTTCTCAGCTATCATGCCAGAGTCAAACTCAaagctgc
tcttcgttcTGGTGCCAGTTTTCCTCGTGCTGattctgctgtttcttcaGTACGTCCTGTAACTTGCATGCCAGACCGTTTGCCTATCAACAAGAGGCGG
AGAGGTTGTTTTGATAAAATGTTTTGCATTGGACGCACTTGTTTACACTTTTCTATCGGTATATCGTCTATACAACACTTTGCTCTATACATCTATCTGG
TACATCGATCTATAGTCTACAGGACTCGCTCACTTCACTAAACGCGTTTAATACATGGCACTGAAGGCCCACTCGACGTTGCTGGCCTCCAGAATACGGG
ACTCGAGGCCAAATTCCGCAAACGTCTTCGACTCAATTTCCACAACCTCCACGTCGTGTTCGTTCGTAGagtcctcctgctcttgct