Description :
From Genome Similarity Track
Location :
Scaffold_19:187800- 219832
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10230hypothetical protein
Phypa_INRA-310PPTG_10231hypothetical protein
Phypa_INRA-310PPTG_10232hypothetical protein
Phypa_INRA-310PPTG_10233hypothetical protein
Phypa_INRA-310PPTG_10234hypothetical protein
Phypa_INRA-310PPTG_10235hypothetical protein

Sequence
32032 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGAGTGGTATGTATCAAAGATACTTCGCAAATGAATCACTAAAATT
TTGCTTGACCCACCGATAGTAGTTTGGGTTCTGTACAGCTATTTCCCTGAAAGTCTTTCCACGATGTTTCCCTACTTGTATTGATGTATCGGGGAGTAGC
TTCGCAAGGCTTTGCTTGTCACTAAAGCTAAAAATATTCATCTCAAACATGCGTTGAATGAAATGGTCATCCTCATGAACCAAGGATCGCGGAGTTCTAC
CTTGGTACTGAGTAAATGATAGAGGACGATCAATGAATGGCTTTGATGAATTGCTTCTTAACATTTGTCGAAGTAGAGTAGTCGCTACAGCATTTGTATG
AACGCTATTATCATAGTGATACTCATTATGGAGCTTGCATTTGATTCTACAGTGATCACAACGCGGGGTATGATACTTGTGTTCTTTGAAGCACTGGATG
CATTTCTTTTTATTGAACTTAAATTTTTCCATACATGTGGATCCAACAAACTCTAGTCGACCAGTAGGAATGTGTTTGATTAAACAATTCCAAATAATCT
CTGTCTTACAATGACAGTTATTCAAAGGTAGTGGGCATTTTCCTTTGAACATGCTTAGTGGATAAATGTTGTTTTGCCAATGTGACTTCCAACCTTTTTC
ATTATTGGTATCCACGAAAGCCTTATTGAACATCCATCCGGTGAACTGGTATTCCTCTAAGTTTCCGAGGTACTCTTTCAAAAGTTGCAGCTTGTAGTTT
TTCATAATTGTTTATACTTTGTATTTCTTGTCTCTAAATAGAAAACTTTTCCATCCATAATATTAGATATTCTCATGATGTGGTATTATAAGGTTTGTAG
GTATGTTTATATAACTCAAAAATCGGGAAATTCTTCATTTCAATATTAGCATATAGATTGGTGCTCTATCCCTTGTACAGAGAAAGTTAAGAAAAAGTGC
ATTCAGGGTACGTAATGGTATAGACAGTCCTCAGCGTACTATCTACGTGCGGTGAAAAAAAAATGGCTATGAAACCAGTATATGATAACTACTGCCGTTT
TGCCGACTCGACAATCGCGTAGGCATCTTTCTCGATAGTAGGCCACTTGAGCTGCGCTCCTGTGAATTGACCACTCAGGAAAGCAAGCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGCAATGATTGGCTCCTAGAGCCCCTGGTACCATGTACCAGGTATTACAAGAGTGACTGGTCACT
CTTCATGTAACTTGGGTACACTTGGGGTTTGTAGCCCGCTACAAAACCTCTCTATTATTTCGCAATGCATGCTTTTATTTTTTATTTAAACTTGTCAGTG
ATTGGAAAAAAATATTAGCAGTAAGGTGTATTGCCGTTTGCCACTGAAGAGCACTGGAATGGTTTATCCTCGGGCAATAATATATATTGAATTATTGAGC
GACGTTGCAATTTTGTATTGCAGTGCAATACATCACTTGTGCCATTAGAATGCAATATTGGAAACCTGAAGTCAACCAAGACTACTTAAAGCAATAATTA
GGTGGAGGAGTTGTGTAAGCCCAAACCACTCAACGAAGCATGAAACAGCTTGTTTAGCATATGGAGGTCATCAGTATACCCTACTAAGTATGTGTTATGT
TTCGGTTGAAACCCAGACCACCACATTAGACTGTATGATAAAGCGAGTTGGCCGACCCTGTACATCATATGCTTGGCTAATTGTGCGCTCCAGGATAGCG
CTAGTACATTCGTACCTAAAGCCACCAGCTTAAGCTGAGGAGGACACTACAACAGAGTAAGCTACTCAAAGAAATCTGGGCAATTTACAAAGATCATTGC
AGTAATGTATTGCAATATTTTTTTTCTCGTGGAATATGATATTTGTACTTCTATTTATGTTGAATTAATAAAGAGTCCAGTAGATTCTGTCTAAAACTTC
TACTACTAAAATTTATATACAAAGGGCACAGTGCAATCTGCCAACACAAGTTGCCTGTTACTTGGCAGGAAGCATCACACAGTTTACTTATGTGTGCATT
AGTTGGTTGTTCAAAACATGTACTTGATAGTATTAATTTTGAGTAGTATTGTGCCATTTAGTAATTCTGCCGCGATTATTCTGGCATAATTCAATTCCCT
AGATACTATTAATACTAGGCTACGTAAAAAAAAAATAAAGCAAGTATTATCGTCAATTAATATTTGAACTGATTCTTTCTTGACAATAATACGTCGCTAA
AAATATTTTTTTTTCGGCGTAAAGGCCAATTTAGTACTTCAAGTAATTTTTATTGGGTGCATGTAACTTCATATGTCGAGTGAACCATAATAGAGTGAAG
TGAATTACAACTACCCTCTCGAGAAAGCATCTTACTTGCGGTCGTTGAAAGTGAACGATCGAGCCTCGCCAGCGGTACTGGTCGAGCCACTGCTGCTATC
CGCAACAATGACAGTGCCGCCCTCCGATGGGGCCGGTGTGGGGGCTCCGGCATCAATTGGGGTTGCTTCGGCCGACATTCCGTTAAACAACACAACATCC
TGTTTCGCGTTCATAGCGGAGGAAGTACCACTCAGGGTCGTTACTGGACCAATGTGGAAGGAATCTTTCGTAAGGATCGATCCTTTCAATTCAGTCTTGA
CGTTGAACACCAGCTCGTCCTGACCCGTACTCGTGTAGAACTCCAACACCGTGTTAACACCATCAGCCGACTTCTCCACACCAATACCAAAGTTGTACCA
TGTGCCAGTCACGAATTCTGCCGACCACCTTGCGTCAGTCGTGCCGTTAGTGCGGTAGTACATCAGGGGCGGCTTCACCGACGCGTCGACACCGATTGTA
AAGACACCAGAGCCCAGGAAGACCAGTTGCCAGTCATACGCGTTTAGGAAAGCTTCTGTCTTCATCAAACTGGCACGGTAGAAAGTGGTGCCATCAGCCG
TGCCCTCGATCTGCTGAAACAAATCCGAGCGACGGGAACCGGTGTTGTCGTTGAAAATGGCTTTGTCATCTACGCCAATCGCCAATGCGCCATCATCACT
GTTGTAGCCCTCTGGGCGAGCTTGATACTGCATACTGATGTAGTCAGCTGGATTGCCATTGTTGCCACCATTGCGTTGGATGAAGATGGGAGTCGAATAC
TTGTTCGTAAGCGTATCAACGGTGAGGTTGTACGCGCTACCGTCCCAGGGCAAGGCGTGATAGCCTGGTGTCGCTGCAGACACGAGCGAAGGCGACACGA
GCGCGACGAGACCTAGGAGGGCGGTGGTGAGCGGCATGATGGAGGAAAAGGCTTGACCGATTGATAGCAAATTGCGAAATAAGGAGCACTTGGTAAGTGC
TGTACGCAGTCCGGCGAAGCACAAACAAGTTGGTCGTTCTTTGGATTGGCTTACCCACGTTGATCATAAGGCTTAATAACTTACACGGTGCCGTGCAACT
TGTCCACTAAAACGTTAGTAGTGAATGACAGTGAACCGCGGCGTATGCCACAAGCATCAGATGGAGAGTGGGAACGAGATTGGCGCTCATTAGATTTGAG
TGTGATCAACTTGCACGTCTTTTCAACAGGAGTGTCCTACACACGGGTTTGTGCGTTTGGCTTTGGTAAGTTTCTCCTTGTTCAGATGAGCGATCATAAT
ATTCTACCGGATGCACTGAACAGCTACACTAGAGAAATGTTGTTGTGGGAACAACAGTCAGCCTTTAAAAACTAGATTTACTCATTGATTTTGATCCCTT
TTTATGACATATTTTGCACTACTAGTACTACTATTTAGGGGGCTGTGACGTACTAGTAATAGCAGTACGTTTCAGCAGCCCGAAGCCGATTGCTTCGGTC
ACGGATAGATTACCAGTGGGGAATCGGAATCCATTTTTGGATAGGGAAGATATGTAACGGGGTACATACCCCAAGTGTACCCAAGTTACATGAAGAGTGA
CCAAGTCACTCTTGTAATACCTGGTACATGGTACCAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAACAAGTGGAGTCCTTTATGGACACCAAGCTGATTGTGATCA
GCAGGGTCCGCGATGCCATGGCAGCGGCCCAGGACAGGCAAAAGGAGTACTCAGACAAACATGGAAGAGGAAACTTAAACGTGTTTAAAGGTGAATTTGT
GTTACTAGAGCCAACGGCTATTCTGCGGTGGTCCAGCAGTCAAATCTTACCTACGGATAGCTGGCGGATAGCCGGAATCCCAAGCGACCTCTCGAATTGA
AAAGCATGCCAGCACGCGAGGAGGCGCGCGTGGCAAGAATTATCACGCGTTGGAGGATCTCGAACTGGCAAAAACCTACGCCCATGTGTCTACAGATGCA
TCTGTCGTATAAACCAGACGGCGGAGACGATGTGGACACGCGTGAAGGAAGTGATGGAGAGCTCGGAGCGTGTAGGCGAGGCCATCGCAAAAGGAACGCT
AGAGCCACGGGCTTGGACAAGTCTCTCGGCTCATTTTGGTCAGGTGCAAAAAGCAATAGCCAAGTACGTCGGGTGTATGAAGCTAGTTGAGTCGCTGCGC
GAGTCTGGGTCGACAGAACGCGACATGATGCAGAAGTCGCTGTCATTGTACAAGGAGCGCCACGGTCATCACTTTAGATACATGAAGTGATATGACGTGC
TCGCGAAGTGTCCTAAGTTCCAAATGTCGGTTGAGAAGGTCTCTGAACGCAAAAAAAAAAAACGCTCTAAGTAGTAAACGTTCTGGTCCTGAGAATGTAA
TCGTGGAGGCATCTTTGAAATCAGATGCTAACAGTATCAGATCTACGACAGTAGAAGCCCGACCAGACCAAGGCGTCAAGGGGGCAAAGCGAACGAATTC
CGAGGCGTCGATGCGATTCCGCACAGTCGTGGCTCAAGAAACCCTGTCAAAGTCGATGATATCCAAAGTGGACGTACTAAAAAAGAAATTCCGGATTAAC
CAGGCTCTTTAACGCTTACAGGAAGAAGAAACACTCCACCGCATGCTGAATGAGCTCTTCAGCATCAAGCCAGAGAGTGCTGAACATGCTACATATCTTG
AAAGACGTCGATCCAGTTTGTTGCGACGCTTAAGCGCGCTGGAAGACCAAGCCACACCATCTCCACCCAGTCTCGAAGAAAGTATGGGAACATCGGGCTC
TACTACTGAAAATGCAATGACAGAGGCTAATTTGAGTGATAATCATTCATTTGAACAGACAGCGGCATCTTATGAGAATGAAAATGTACTCGCGTCTCCT
GCGAAGTTGAGTGCTGTGTGTCCTGTGGTACTGGAGAACGTGACATCATTATCGCTCTCTGAAACACAATCCTCGTTTTACTCATCAAGCTTCCCACCGT
TGGCGCAACCCTCGCAAATAAGCAGTGAAGTGGATGAATCCCAGGTCTATACCGACCAGATGTGCACTTACAGTTAACAGTGTCAATCCTGGATAAATCC
ATTATTCACAAGCGCCGATTACGAATAATGAGCCTTACATAATGATCGAATTAGTCGAATACAAAACCAAAATTCATTCTGAAGTGTCTTCTTCTCCAAA
GAATTTCCAAATGTGCTCCATAATGGCCTGTTGCAACCGGAAATACTGTGGTGAAGCAGATTCAGAATATTCCGAGACTGGGCGCTATCAGTTCCAATCA
ATCAAGATCGACCACCACCCATTATGGCGATCTTGGTGTGGTCCACGTCAAACCTGACCAAACCGATGGCGATCTCAAGTGTGGCATACATCACACCTGC
CCAAGTCAATTGTACCCACGATTTATCAAGTCTGCGAGGGATTATGCGATCATGAGGTAAAGGACCCACGATCTGGACCCGCCAGTGGCGCAAACAGCCG
ACCAAAGAGCCAGTGATACCCGGGGATGGGAGAGAGTGATAGCAGGCGTTCAGGATCCTCAGCGTTTGACATAGGACGAGGCTAGCCCATTAAACAGTGT
TGTTTTTACTTCTTCCTTAGCAAGTGTTCTTCGTCTTCGCTATTCCGGGCACGGGATTGACTTTGGCCCACCCGACGACGCGCTACAGACGTACCTACGC
AAGATCGAAGTTCGAGCGCCTCGATTGCTTGACCAGAAGGCGATTTGCCGACCTAAGATACCTTGGGCCAAGACCAACATCGGCCCCCAAAATCGTCGAT
CTTACGCCTCAAGATCGACAGAGTGCGATCTTATACCTTAAGATCGACAACTCAAAACCGTAATCGACGCAGCGAGTAGAAGTATCCCCGCTGCTGTCAA
ACGTCCCGCTGTCTACCCAGACAGTCCAAGAAAACAGCCCAAGCGTCGCTTCCGAGATCACCCGAAGAGCGAATCGGCCCACCGACGGGTACACAAGGTG
AGCATTACAACTTCACGGAAGATCGGAGTACCCCCTCCGTTAGTCGGCAGTTCGGACGCAGTGTGCAAGAGGACCTCAGCGATCAGCAATTTTCGCAGAA
CCACTTCGCCACAGTACTGCTCTGTGTTTTCAATTGCATTTATCCGAGCCGCAAGCTCTCCAATTCAGCGTGCTCGATTCCCAAGTGGACGCGAGATGCG
AAGTTTATAGAGATGTAAATGGTCATGATCATTGAACAAATACCCGTGCTCGTCGGCGAATGAGTGTCGATTTTCCTCACAAATCATGTTGTGTAGAATA
ATACAAGCACGCATCACGTTAGGCGTAAGTGAAGCTTGCACGGCACAGCCAAAATTCTCCATCGAGCTTGGATAACTCCAAAAGCCCGTTACACGTCTTT
CCTAACGCTTTCTTGTCTTTGTGTGAACTTCTTTTGCATTTTCCCACGCGGCTGTAGCATCCCTTTCATGAAAACAGGCCAATCAGGGTATATGCCATTG
GCAAGGCAATATGCCATATTGTACGTCTGCCCATTCATCTCAAACTCAACACGAGGAGCGGTTCCATTCATGAGATCATTAAATACCGGATATCGAGTAA
GAATGCTGAGGTCATTTAAGGAGCCCAGCCACCCGAAACTTGCATGCCAAATCCGTAGTTCCTGGTCTGCACATGCTTCTAAAACAACGGTAGGCTTTTT
TCTTTGCCCTTAAACTGTCCTGCCCACCCATAAGGACATTTCTTCCACTACCAATGCATACAGTCGATGCTACACCACATCCCGACGAATCCGCGGCGAG
CATTCATCTCTAGAAGCCTCTTCAAGTCCGCCTCCGTTGGAGAGCGAAGGTATTCTGCTCCAAACTGTTTGTCAATCGCCTCAATGAAATGCATGACACT
GTTGTAAACTACAGTACTAGACATTTCGAGGTTTTCATCTAGGCAAACGGCAGGTAAGGCGTACGCGAGTATACGCAACGTGGCGGTGACCTTCATTATT
GGATGAATTCCCATCTTCTTCGTCGCATCAGGACGCTGTTCAAAGTATGCTGGATCTGCCTCTAAGACACCATCTAGCACGCGCTGGAACATGGTCTTGC
TCATGCGGCTGCGTTCACGAAAGTCATTATCGTCATACACCGGGTCTTCACCAAAATACTGTTTCATGAAGCGCTCATAACGCGTTTGAAAGTCCCTCTT
CTTGTTCGGTCGTCCATCCAGCAGTAGATACTGAGCGATAAGGTCGTCGTCATCGTCTTCATTTCCCACCGCTAGAAGGTCCTGGAAGCCGCTCCGAGCG
GCAGTGAGTTCACGAGCAGTTGCAGGAAGATCCTCCATGCAAACGGCGTTCTTCGTCTTTCAGTAGCGAACGTTTTGAGTGTTTTTTTTTGTCGAATGGG
TGCGGTTTTTACAGCAGGTCAAATCTGATAGCGCCGTTGTCCGATCGCATCGAGCTAATTATAACTTTCGTTTAGTAAAAACCGGTGGGAATGCCCTAAA
CCAAACAGGCAATCTCAACCTACACATAGCCCTAATTCATTAACAGTTATATGTTAGCAAAACAGGCTTTTACGCTTATGAATTAATTATCATCACCAGA
ATATGCTCCAACTTGAATGGCTTAATTTAAACAGCGTGTCTGCTTTTTCCTTCACCCACTGGCATACCTAAAACCGGCGGAGATAAGACAACCCATAATT
AACACGGAATTAGCGGACCATAGGGCATAATTAAGGCTGAGAAAGGAATAGAATTATGCCAGCATAATCGCGGCAGAATAACTGACAGGCACAAAACCAG
TACATACGTAGCAACTCAGAAACGCATCGAACAGTGGACATTTATTCCAACAAGGTAGGTCTAGCCAAGACAGCGCAAACTGCATAGCCAGGTGCGTGCA
TCACTTCAGTGAAATGAAGACGGACATAATTTTAGGTGCACTTACTTGCGGGCACAGCCGCCATCCGAGCTCTTGACGATGCCCGTCTTGGTGGCGGGGA
TCTCGTTCTGGGTAGCAGGGGTCTCGTTCTGCGTGGTCGGGGCCTCGGTGGTCTCAGTGGAAGCATCAGACGAGGACTCAGCGCCAATGGATCCGGTAGT
CTTGGTAGACTTGGACGCAGCACCGCCCGTGGCAGACGTCGAAACGTCAGCCTCCACCGACACACCGTTGTAGGACACAATGTCCTGCTTGGCGTTCATC
TTGGGCTCACTGCCATCATCGGACAGGGTCAAAAGACCGTAGTGGAACTCATAGTTCGAGGGGAACTCGGTCACCACGTCGTGGGTGGCCTCAAGAGCGA
GGTCCTTGTCGCCCTCGCTCGTGTAGAACTCGAGCACGGAACCGTTGCCCGAGGTGGCGGCCGAAATGCCGATGCCGAAGTTGTACCACGTGCCGAGCTC
GAACTCGGTTTCCCACTTGGCATCCCAGGTGCCGTTGTTCAGGTAGATGATCTTGGCGGGGCTGGCCGTGGCATCCACACGGATCTCAAAGATGTGAGAC
TCCGGGAAGATCATCTGCCAAGCGTACGGGTTCAGGAAGGCCTCCTCCTTCATGACGCTGGCGCGGAAGAAGGTGGTGCCCTCGGTGTTGGCGGCAATGT
TCTGCACCAGCTCCGAGCGACGGAAGTTGGTCTGCGTCTTGAAAATGGCCTTCGCGTCCACGCCAACGTTGATGACACCCGTGTCCTTGTTGTAGGCGGG
CGAGCGGCCTTCTTTCTCGATGGACACGTAGTCTGACACCTTTCCGTCCGTGCCGTTGTTGCGCATGGTCAGGATGTGCGTCAAGTACTTCTCCGGCAGC
GTGTCGACGGTCAGGTCGAATCCACGGCCGTCCCATGGAAGAGGCTCATCCGCAGCAGCGGCAGGGGCAGCAATGTAGGCCGACGCGAGAGCCGCCACGC
CAAAAATCGCAGAGGAGAAGACCATGATGCTAAGAACGAGAACTCTTGAGGTGCGTCGCTGCGAGCGGATTGTAAAATGGCCGTGGGGGTTGCCTGGCCG
TGGCGCTGTCACCTCCAAGAAAAGGTTGGGCCCGGGGAGTCTCCGGGGGACATTTCCCACCGGCAGGCTGGGTTTGTCAACTCGCCATAGTCCGGGATTT
GCAAGGTGAAAGCGCCAAGTTCATTCGCCAATTCCTCGGTCTGCCATGTCTTTCGCCGCTGCCAATCTCCATCTGAGTGCTCGAGAGCTCGCCAGAGCCA
GACGGAGGACATCTTTAAATCGGAGACAAGGTGTTTGATACCCTTTTATAGGAGACGACGACGCTTATATAAGTGTTCAAGATTCAGAACTCTTGCACTG
GTGTCAGATTTGACGTCCGTAAACAAATCGAAGAGGATAGAGCACGAGCAACTTGGTTTTGGTATCGCGAGCAATGCGAGGAGACGATCGACGAAAGCCT
TGCTTGAGGAGGCTTTGTAGAGGATACACTGGTCGGGAAAGCGTCAAACGCTGGGATCACTTGGCCAGAGAAGGTTTTTATGAGCTCGATCCCGTATGGG
TGGGTGGGCCAGCATTTGAAATGCTGCATTTCAATCGGCCTCCATGCCAAGCATCGGATGGGAACGGAGAAGCGTGCGTGGATGTCTTCAACTCTTGAAA
GACTCGATGGCTTTGCTCTTCATGTTAATCGCCTACGACGAGCGACGTACGTGTTATTTAAATACCGGTAGGCAACGGCAATCGTTAATGCTCGACTTGG
AGTGTTACGGTGCATTCATCACCACGTAACACGATGGCCACCAAAGCTTTGCAATTGGAAGGGTTTGGATCGAGCGCTTATGGGACACATCTGAATGTTG
AAGATCTTTGTGAGGCCTTTGCATTGACGTTCCGATCGCTCTCGTTCCTTTGGAATGTGCGTTGGCAACTCAAAGCGCTGTTTATCGTGAAAGATTCATT
CATCTTGACATTCGAGGACTGCAGGAACTTGTGCTTCGTTACTTGTCCTAGACAAATAACGCTTTATAAAATTGGGCATTCCTTCTCTTGAGCACGGACC
CCGATACTGTACCTACAGAGCGTAGCTCGCTTGTGACTTGCAATCAAGTTTCGCGAACTCAGCTTACCATTCTGTCGTGCACGAAAATGATCTTATTAAT
CCTGCATCCAGGAAACCCAACACAAGCGAAACTCAAACGTCTTCTACTAAAAAGACAAACCGTCGCAATTATGCCTGCAATGCAACGACAAGGGTATTAA
TGCACATGTAATGCGTGAAGAGAATTTTTAATCACCTTTTTTTTAGTAAAAGCGATCGTTATGATTGATGAATGCATTGACGAGTGCTGTGGATTGCGTG
ACGAATACATGTGAAATGAACTCATTGAAATCTCGCGTCGGTACATAGGTGTGTGCCTACTACTATCGGCTTTTAGTGTTCGTTGCTTGTGACCCGAAGG
ACTCTCTTGGTGTAAGGGCTCTTCCCCTTCTTGTCGGGCTTGCAAACCGCGAGAGGTGGGCACGGGGCTCGGATGCATTGGACTTGTTCGACCTGGCAGG
TGTAGCCTGACGAACAGCGCACCGAAGCACAAGGACTAAGGCAGTATTGAGAGCTGTCCGCCGAGTTGATCTGGCACGTTTCACCCTCTGGACATTTCAT
GGTGCACACAGGCTCAGGCGGTAGCGATAGAGTCTCAACCGGAACGCACGTAGGGACCGGATCACATGGTGCGGTGATGCATTGAACTTCTTGCAGCGTG
CACGTCTCGCCCTCGCCGCAAGGGAGGTCGCATGCAGTGGTTTCTGGAGCGGCGTCAGTGGTGGCAGTCGCAAGGGCCACGAATAACACGGTGAAAACGG
CAGCTACGCGCATCTTGGCTGGAAATCTTGTAGTTGGGGTCTCGAAGAAGATTGAGAAGTGAGAAGGTTGAGGAGGTGGCACGTGGAGCAGACTAGCTGC
GAGGGCACGCACCTGTTGCTTACGTGTAAACAGCAAAACGGTTCAGTGCCGACAAGAAAGCTCGCGCATATGTGGTAGAACACTTCGCCTTGAATCCTCT
ACCGCTGGAAATCCATAGATCCCATACCCTATGTTGCTAGACCATACTCCATCGCCGGAACAACATGTAAACAACTTCGACATGCAAACGTGTATTGTTT
ACCGCGCTTTTCTTCTTAAGGAGCACTTGGTCACTTTGAGTAAGCTTACTTGTTGCACGTCGCCATAGGTGGGCATGGTGCCCTGATACACTGCACTTCT
TGGAGCTCGCAGATAGATCCTTTGGGACAACGACCCTCAGCGCACACGTCGGCGCAGTAGTCACTGCCATCCGGCTCGTAGATACGGCATTCCTGGAAGT
CTCCGCATTCCATAGTACATTTTAGCGAACCCTCGGCACCCTTGTTGGGATTGCTGGTCTTACCGACGCACGCTTGAATTGGCGGACACGGAGCGCGGAT
GCAATCCACCATTTGCAGCGCGCAAGTCTCACCTGGCTGGCAGTCGAGAGTACAGGCTTTCGTGACGCAGCCCTCGGCTTTGACAACTGCAGGTAGCGCC
AACAAAAGCAGTTGAAGCAGCTGAATCGCAGCTTGCATTGTGTTGGGCTCGACTGGAGAAGAAATCCCGAAATGGGCATACCAAAAGAATCGAGTTTGGT
AAAAAGTCTTTTTTCCTATTATTTTCCATGATTTTGGTTATCGTTCCTTTAGGATGGATGTTACGCATTGTAACCACTGACGTTTTGTGCTGGTGTTTTT
CATTTTAAATCATATTCAAAGTAGACTCTAGTGATAGAAACCCTATCACTAGAGTCTACTTTGAATATGATAGAAACCGATGCCATCGTCGGCGAAGTTT
ATATCCAGTCGCGTTTGCCTAACGAATTTTTCGCTCTTCTTCAAACTCTTGATCCTGTTCCTTAACTGCTCAGGTGGCGTTGGAATTGTTGTGAAGCTGG
CAGGAATTAGATTCAAAAAAACATTCCGTAGTATTGAACAACTTCAATATGGATTTTTCGCGTTTCGAAAGAAGCTTTTGTTGCTCGCGTTACTATATTC
TACCACAGGAGGACAAAGGGTCGTGAAGCACTCCAGCTTTTTCGGGTGCCCAGATGGAGTGGAGCTTTCGGAGTAACCGCTCCTCTGAGCATGCCTCTAT
TTGGATACGCAGGACTTCCTGTCATCGGAATTTTTGGACTCCCCGCATTCTATTGCTCGCATAGTAGTGTCCTCCATACTGTTTGAACACTTGGTATCAC
TGTTCGTAGCAACGCAAACTTGAGCACGGATCCGTAATGCAATACACCATGTGCAGTACGCAAGTTTCACTAGGCTGGCATCAAGAGTACAGTCATTCGA
ATCACGGACATCGGCGTGAAAAGTGACAAAGGTAGGTATGAACAAGGCCATAGATCCAGAGTTATACAATTCGAAAGGAGTGTACGCCAATGAATAATTA
CTTCACTGCCAAAAAATCGACGTTATTCTGAACAACTTAGTCAAGCCGTTGGAAATGGGCAGACTCTCGAGCTAGACGCCGAAGCTGTCGTTGGCGGGAT
TGACATCCAGTCGCGTCGACCTAACGCAGCCTCGATCTTCTTCAAGCGTTTGATCATGTTCTTTATCTGCACGGGCTTGGCTGGCAACGTCCAGGTGCTG
GATTTGTCGTGGATCTGGCAGGTGTTTGCCTTCAACATTGCGAGTTGCTGTACTACCAACAGTACCATCGCACTTTGTTGCATCAGCTCGGTTGTTATCC
CCTGCAATGTTGCGGCCTGACAAGCGAGCTCAAGCTGCTTCTCGTGGCATTGGTCACTGTCCCTCTTCTGCGCTCGTTCGTTCTTTTTCATCAGCTTCTC
CCGAATAATCAGCACTTTGAGCACTTTCACACTGGCGTCCAGCACCTCGTCGTATTTTTCACGATGATGTCGTTTCTCCAGTGCCCACTTCGCTTGTTCA
TACTCGAACTGCTCGTGATCGCAGGCTACTTG