Description :
From Genome Similarity Track
Location :
scaffold_17:187769- 189013
Transcript NameFunction/comments
Plaha_PHALS_11097Mitochondrial/chloroplast ribosomal protein 36a
Plaha_PHALS_11098translation initiation factor sui1

Sequence
1244 bases(100 bases per row)
AAAATGGCAACAAAAGGTGTTTGGCAGCTGAAGCAGGTGACGATCCGTTACTGCCAGCACAGTGGCAGCAGTCGCTATGTCCGGCAGCTGCTAAGCGATG
ATCGCTTTCACAAGTTTGTCGAGGAAAATCCACAAGTGCACTTTAAGACGGAACTCAAAGGCGCCCGCCACCCCATTCTCGTTGGGGAATATGGTATGGC
TAGTCACCATCGAGTCTGAATTAATAGATTAAAAGCAAGCTGGCGTGTTTTTGCAGTGACAAACCAGCGTAAAGTGTCGGACATTAAGAATCAGGACATA
AACTTCATCATGAAGCAGGTAATTAATGCTTGACTATTTAGCGTTGCTACTTTTGTCAACTTTGCTCATAATTTCTTTGCAGCTGCAGCGTCTTCGTGAC
TCAAGTGGCCGCAAGATGACGCATATCAAGAAGCCAGTCATCTCAAAGCGTATATCCGTTCAGGGCATCTGGCAGCCGACACTCAACTTTCCTGAGTTTA
AAATTAGCGACCGCATATAGAGGATGATTGAAGTCAGTAGTATACAGGAATGTCTTTGTGTGACTCGCTACACAAACAATTTGTAGTCGTATTGCAAGAC
GACATAGCTTCGACGATTGCAATGGCATAGACAAGACCCAAACAAGACATAAGCATTCAATATGTTTCTGCTATAGGACAAAGAGAAGCGGCTTGTCACC
TTTTTCCGTCTTTCTTTAATCtatttcttgattttcgAGATTGCAAGCGTCTTTGACACACTGCGGGCCTCAGCAGCTAAATGCTTTAGCACATGTCACC
TATATAAACCTTAAAATCCGTGCAACACCACTTGAGTGTCGGAGCAAATTTCTTGATCGAGCAAAAACTCGCGGGTGTTGGTTCGCTGGTCGCCAGACAA
CTGAATAATTTCGCCCAGCTCGTCGTCCTTCACGATGGCACCATTGCAACTAAAGTTTTTCTTAAAAGCCTTTAATATGCGCTTCACATCAAGGTCATCA
GCTAGACCCTGTACTGTCGTCAAACATTTGCGACCGTTGCGCTGCTGGACACGCACATGCACCTTGCCGCCACCGATACTAGAATCGTCTTTTGCATCCG
CAAATGCGTCTGCAGAGCGACCAAGGAGAAAAAATAGTGTCAGTACAATGTCATGCATCGACTAATAGGTGAAAGTTTAGTATATCGCCATTAAGTTGGT
CAAAAGAACGCACCAAAGGTCTGGAAGTTCTGAATGTCGGTCAT