Description :
From Genome Similarity Track
Location :
Scaffold_361:18768- 26745
Transcript NameFunction/comments
Pytir_DAOMBR486snap_masked-pir_contig_361-abinit-gene-0.26Voltage-gated Ion Channel (VIC) Superfamily
Pytir_DAOMBR486maker-pir_contig_361-snap-gene-0.16Pseudouridylate synthase
Pytir_DAOMBR486maker-pir_contig_361-fgenesh-gene-0.2Mitochondrial Processing Peptidase alpha subunit
Pytir_DAOMBR486maker-pir_contig_361-snap-gene-0.17RUN and FYVE domain-containing 2 isoform 1

Sequence
7977 bases(100 bases per row)
TGATTCATCATGAAGCGATTCTGTAGAATCTCCAGGTCGATGCGGAACTTTGCGAGCTCTTCGTCCTCGAGCATACCATTGTTGTCCTCGTCGTAGACAC
TGATGACGTCGTCCACGTCCAGGTGGATGTCCTCCGTGACCGCGTGGAACCGCTGGAGGATCGCTTCAATCTCGTTGCGGCAGACTATGCGCTTGCCCTT
GAGGTAGTCGACGTTCGACTTCATGGTCTGCTGCACCACGCTCTTCATCACTTTCTGGAAGTTCGTGCCGATGACCGTGATGGGCAGCGCCAGCACAAGC
ATGCCCGTGAGTACGCTCGCGCAGCCGACGATCTTGCCCAGGAGCGTCACGGGCGTCATGTCGCCGTAGCCGACCGTCGACATGGTCACGATGCACCACC
AGAACGACGACGCAATGCTCTTGTACGGATTCGGGTCCACGCAGATGCAATCGGTCGACGACGCCGCGCGCGCCGCTGCGGCACCCGCTATCGATGACGC
GAACATTACGGAGCCACCGTTGTCACAGTCGCCGACCCACCCACCGGCGCGACAGCCGTCGTGCGTGAACTCGGCAAAGTAGATCATGCTCGAGAAGACG
ATCATGGCGATCGCCATGAGGAAGATGAGCATCGACAGCGCCTTCATGCTGATCGCGATCGCCTGCACGAACACCTGGATCGCGGACGAGTAGCGCGACA
TCTTGAGCACGCGCGCCACGCGTGTGAGCCGCACGATGCGGATCGCGCCGAACGTTCCTGCGTTGTCCACTTCAAGAATGCGCTCGAGGTAAAACGGGAA
AATGGCCGAGATGTCGATCCAGTTCGCATAGTCTGTGTGATAGACATAATACAGAGATAGACAGATAGATAGATAGATAGAGAGCATTAGATACAGACAG
ACCTGCGATTAGAAGTATACAAGAAGTACCTTTCAAGAAGGCGCGCTTGCTTGGACACGCGAATGCACGCAGAAGCAGCTCAATTGTGAAGATCCCGGCG
CAGACCATCTCCACAAAATCGAGCTCTTGCGCATAAATAGTGAGCTCCTCCTCCGTCTGCGCGATGAACACGATCGTCGACACGATCACGAAGCAGAAGA
TGCATACCGAGAGGTAGTGCGCCATCTGGGACGACTGCGGATCGTCCATAAGCAGCCACAGGCGCTGGGTGGCCGTAGGATGCGGAGGAGGAACGACGAC
GACGACCACCAGTTCTTGCTGCTGCTTCGTGTCGTTCGGACTCGGACTGCGCTCGACCATCGTGGTCCGCGCTTTCGAGCCCTGGCGCTGCATCTCGGTC
ACTTTCGAGTCTCTCCTGAGCTCTCCAACAGCACTGTCCGTCTTTCGAGACTCGCTTTCCTTCATGCTCGGCGGCTCGCATTTGGGCATGGGCGCCACGA
CGGAGCTTCGTTTGCTGCTCCCTGGCCGAGAGCTCTCGCTCCACCTGCGTGAGCTGCGGTTGAATGACGACGCGAAGCTCGAGCGCATGCGCGACGTGCG
ACTGCTGCGGAGCGCCGAGCTGCGCTTCGCCTCGCGCTCGATCACCTGCGAGAGCTTGAGCGCCGTGTCCGAGAGCTCGCCGCGCGGAGGCGTCACCATG
CTGTGTGAGTGTAAATGGAGGTGTCAAACTAAACTGCACCCACTTGCCCGCCACCGTGATCGATCAACAGTTTGGAGAGCGAAGAAAAGCGGAGCATGTC
TCTAAAAATAGACGCGCGCGCCGTTCCAGTTTATTTTTTTCGTTGGGATATCTATTCTTAGCCGCACTGCAGTTACGCCTGTCATGCTCGATGTGGATGG
GATCTGTTGTCCATTCTGAGGCCGTTGATTGACTCGTCGATTGGCTGGACGAACTCCACGCATCTGACGTTCATCTGATAGATGTCCAGCGAGCAGACTA
GCTCACTCCAGATTCTGTTCGCCTGCAGTCGAGTCCTATTGATCACGCACCTCTACTACTCGGTGGTGCCCTCGTCAGCCTTGGTAGCTGTGGTGGTGGT
CATCGTCTCAATCTCACCCTTGGCTTGCGCTTCAGCTTCCTGAGCAGCACGCAGAGCCGCGGCCTTGACGGCTTCGCGCTTGCCGGCGCGGTCGGTCAGC
GCCGCGAGTTCCTCTTTCTCCTTCTTCCAGACCGCGTACGGCTTGGCGACGTAGTCGAATGGTAGCGTCTCGAGCGTACGCAGCCACTTGGCGTACGTGC
GCGTGGCCTCTTCGTGCTTGATGATGTGGTCGAAGATAAAGTCGCGCTTGAACTTCTCCACTGCGGCGGCCACCTGTGGGTCTTCCAGGTCGAGAGGCGG
GTGCGACGTCTGGATCGAGTCCTTCATCTTAAGGTTGTAGATTTTGAAATGCGCCTGCGCGAGGTAGAGTCCGACGCTCGGCGCCTTTGGCAGATCCATC
TTGTCCAGCTGCGTGGCCTTGTCGATGACGCTGATATCCGTGATGCCCGCGACGATCTCCACGGCCGTGCCGATCATTTTGCGGATGTGGTGCAGCAGGA
AGCTCTGTCCAACGACGCGCAGACGGATCCACTCCATATTGTTCTCGACAAACGGCTTCTCGGCTGCAAACGAGGTGATGTAGCGATTGCACTTTGGACT
CGTCGGTTCGAGCTTGGACGTAAAGTTGTGAAAGTTGTGCGTGCCTTCGTACTCACGCAGCACCTTGTTCAGCAGCGCGTGGGTTTCGTCGTCCATTCGG
AACTCCTGGTGCTGCTTGAGCGTCTCGGGGGTGATTTCAATTTCCGCGTTGATCTCTTCTTCAGCGTCGTGCAAATTTGTCGGCCATTCACCCGCAGATG
ACAGCATCAGACTAGCGGCAGAACGGGCACGCTTACCAAAGATGAACGTTGGTGCAAGGTATTCGTACGTGCGCTGGTCGCACGCCATCTTCGCGTTAAA
GTTCTTCGTGACCGTGACCATATTCATGATGCGAATGTCTTCCGGCAGTGCGGCATTGGCTTTCGCCATAAACGCTGGAATATTGTCGCCAACCTGGAGC
TTCGCGGTCAGCATCTGGCCCGCAGCGTGCACACCCTTGTCCGTGCGCGCCGCACGACTCCAGCCGACCTTCTGCAGGAAACCGTAGTTGGCTTCTGTGA
TGCCGCCAGCTTCAAACAGTGCACGCTCCACTTCTGCCTCAATGGTCTTCACGCCTTCGTTCCTATAGCATCGTCACACAAATACACAATCCGGTGAGCA
TCCATCCACACACCTGCTAGCATCATATCCAATTTTAAGAGGCACGTACATTTGCATGCCCGAGTAGTTCTTGCCGCAGAACGCGAGCCAGATACCGTAG
CGGCGCTTTGGCGCTTTCTCTTCGGCAGCCACATTCGCATCACCTTCAGCCGGTGCAGCGGTAGTAGCAGCCTCATCGCCCTTGGCAGCGAGTTCCGCTT
TTCGAATCGCCGCGTACGAGCCCGGGTGGATCGACTCCGAGAAGCCGGCGCGGCGGTCCACGCCCTCATTCTTGCGCGCACGCTCGCTGCGCTCACCGTC
GGCGTTGCCGTCACCGTCACCGTCGCCCTCAGTTCTCGCCTGTTTGTTCTTGCGGCGCACGGCCCAGTGCGTCTGCTTGCGCTTCGCCATTTTCCACCAA
GTCTCCTGTTGTCTTTTATCAATACAGCAATTGCTCAATTGGAGCTCTTCACAAAAAACAAAACAAACAGAAGATTGGCTGGAAGCGCGCTTGAGGTACA
CTGTACCCACTGATGGTACAATGTACCTATTGTGCTACTACCAAAGCGGTTCACTGTACCATCTGACATGGATCTTCACGGTACAGTGTACCGGCAGCCT
GGTGTGTCAATCACCTCCACTCTCAATCTCAACAAACCGAGACCAAGAGGAACAAAAGAACTCCAGAGCCGCAGATCACAAGACAGACCAGCAACCCAGC
AGCTCACCATCACCATGGTGCTCGTCCACAACGCGCTGCGCCGCGCTGTCGCGCGCTCGCTCTCGGCCCACGCGCCGCCACTTCTTCAAGCGCAGCAGCA
GTCGAAGCTCTCGCAGCAGACGCGCCTCGCGCTGCAGACGCGTTGCTTCTCGCAGGCGAACCACCCGACCGACGCCGTGGACCCGAAGGACATCCTGCGT
CCGGACATCGTCGCCAAGCCGCAGTTGCCGCTCGACCAGGAGCTCCCAGGGTGCGTGTTTAGGGAGTAGATGACTGTATTGCGCGTGTGTAATCCTGAAC
TGTGTGTGTGTATATGTGCGTGTGAATGTACGTGTGGCTATGGGTGGCTAATGAGCGTTGGTGATCTCGACTGTGTTGTGTCATTTCATTAGATTGCCAA
AGCTGAAGCCTGCGAGCCAGCTGCAAGCGCCGCAGACTGAGATCACGGTGCTCCCGTCTGGACTCCGTGTGATCTCCCAGGAGACGTACGGCCAGGCGGC
GACGCTCGGCATCTTCATCGACGCAGGAAGTCGCCATGAAGACGGTACTTTCATTGTTTCTTTTTATTGTGTTCATCCGTGGATATTCACTCACTGTCTC
TCACACGTTGCTTTCTGATATAATAGACTCGAATGTGGGCGTGACCCACTTACTCGAGCATCTGGGCTTCAAGAGTACAACGACGCGCTCACACGCGGAG
CTCGTGCGCCAGATCGAGAGCATCGGCGCGCTCACCACGTCGTCCTGCGGCCGCGAGCAGATCATCTACACGATCGATCTGCTGCGCGACAACGTCGAGA
AGGGGTTGGAGATCCTCGCAGACTCGGTGCTGAACGTGGACGTCGACGCCGAGGAGATCGAAGGCATCAAGGCCATCATGCGCTTCCAGACCGAAGATTT
GCTCGAGAACCCACAGGCGTTGCTCCAGGAGTACGTGCACGCGGCAGCGTACGGCGCAAACGCGTCGCTGGGCCGTCCGCTGCAGTGTCCACTGGACAAG
ATCGATGCGCTGACGTTGGAGAAGGTGCTGGCGTTCCGCTCCAAGCACTTTGTCGCGGAGAACATGGTGCTCGCTGGCTCGGGCGTGGACCACCAGTCGC
TCGTGGAGCTCGCGAACAAGCTCTTTGCGAACATCCCCAAGGGCGAAGCACCGTCGCACCTCGAGCCAGTGGTGTACACGGGCGGCATCCAGACGATCGA
GAACCCGGAGTCCATGTTCTCGTACGCGGCGCTGGCATTCCCGACGGGCGGCTGGCACCACGAAGACCTCGTGCCAGTGTGTGTGCTACACACTTTGCTG
GGTGGTGGCGACAGTTTCTCGGCCGGCGGGCCGGGTAAGGGCATGTACTCGCGCCTGTACACGAGCGTGCTGAATCGCTTCTACTGGGTCGAGTCGGCGT
TTGCGTTCTCGTCGATCCACGCGGACGCCGGCTTACTGGGCATCTACGGCGCGTGCTCGCCGTCGCACACGAGCAACCTCGTGGCGCTGCTCTGCAACCA
GATGCTCAACGTGGCGAACCGCCCCGTGGATCCCGTGGAGCTCATGCGCGCCAAGAACCAGCTCAAGTCGTCTGTGCTGATGAACCTCGAGTCGCGCATG
ATCCTGTACGAAGACATTGGCCGCCAGCTGCTCACGTACGGCATGCGTGAGAGCCCCGAGTCGGTCTGCGCCAAAATCGACCAGGTCACGGCCGCGGACA
TCCAGCGCGTGGTGCAAGACGCCATGCAGCACCCGCCGAGCCTCGTGTACTCGGGCGACCTGAAGCTCTTCCCAGGCTACGAGCAGGTCATCGGCGGCTT
GAAGGAGGGCTTAAAACACTAGACTATGTGGATATGAAAGGATACGAATGGAACGCAAGGCAAGACAGCACTTTAATACACAGGAATACACACAGATAGT
TCAGAAAAAGCAGAGCCTGAATATGAGCCAAAGCCTTGTTATTGTCGTCTCTTTTGAGACATTTCTTCGTGCAGCAAGCGGAAGCCGCGCAGAAAGTACT
GGCATTTCTCCAGAGTGTCCGCCTCGATGTCCAGCGTCCGACACGGGTGGACAAACACGAGCGAGAGACACTTGGCCGAAGTCTCGAGTTTCCGGCGCAG
GAACACCTCCGTGGTGGCCCCGGAGATCACTTCCACGAGGTCGTTCGTCTCCACTTTCGCGTCCGCGCGCGGGGACGCCAGCGAGACACCGCTGGACGGC
GGCTTCCATGAGATCCAGCGGCAGCCAAAGTCCGAAAAGAGCACCCTCGCGTGCGGATTGCCGCGAGACCCGTACTTTGTGACCACGATACCGTTCACGA
GCTGCTGCTTGAACTGCGACAGGAATTCCTGGTCTCGGCTGTGATTCTCGAGCCGCGCGCGCGCGTTCTCTTCGAGCCTATCAAGAGCTAGACGCAGCTG
CTCTTTCTCGACTCTTTCTGCCTTGCAGCGCTTCTCGAGTGACTGGATCTGGTGCTGGAGTTCTTCATGGGTTGACGAAGAGCTCTGCTGCACAGCGAGG
TGCTTGGACTCGAATTCGCTCAGCAGAGCGCGCTCGCGGCCTTGCGCNNNNNNNNNNNNNNNNTATGCAGCGAGCCAATTTCGTCGTGCAACTCGACGCT
TTTCAACGTCAGCGCCTCGACTTCGTGCTCGTAGGTCTGTATCATCTGCTCATAGCGGGAAGACTCGACCAGGAGCTCATCGCGCTGCTTCTCGACTGTC
AANNNNNNNNNNGTCTCGCAGGTGCATGAGCAGACCAAGGTACTCCGTAATTTCACCTGATGTTTCCTGCTCGCCTCGCCGACCTAATAAGAGCTGGTCA
AGCTCTGAGCTGGTACTCTGAGTAGCTTTGATACCCTGCTTGAGTATCGACAACAGCTTCGTCTTCTGGTCCAGTTCCTGAGTGGACAGCCCCAACCGCT
TCTCCACATTTCGTTGCTGGCCCTGGGCTTCGACGAGTCTCGAGTGGAGCTCTTCGGCGTGGTGCGACGAGTCCGAGTGCTCGAGCCGGAGCTCCTTGCA
CACGAGCGAGAGCTCTTCTTTTTCATGACGGAGGTCGTCGACCAATTTCGACATCTCCTCACAAATGCAACCTTGGTCGACCATTTTACCCTGGAGGGTA
GAGTGCGATCCAAGCAGCTGGGTATGCGCTTGTTGGAGATGCAAAAGCTCATTTTTCGCCAAGTCAAGCTCACTTTTGAGTCTCGTGGCTTCTCGCTGCT
CCTGCTCGACCGTGTTGAGCAGCATGTCGCTCGTAGACTGGCGCTGACTGGCGAGAAGCCGGTTCTTTGCGATGACGGCGTCGCGTTCCTCACGGAGCCT
GAGTCTCTCAGTCTCCAGTTTCTCCTTTACAGCAGCGATCGCGTCGCGCTCCTGCGTCATGCTCTCCTTCTCAAGTGCGATGCGGTCCTTCTCGCGCTGG
AGATCGGCCATTTGCTGCTTGACGCTAGCCAACTGGTCACTCACGTCCTTGGCTTTGAGTTCGAGGTCGCTCGCCAGCGCGCTTGCGGCTCCAGCTCCAG
TGTCAGCACCTCTTGCTCCCCAGCCTCCCCCATGCAGGAGTACGACGCTACTGGTGCTGTTACGACGAGTGATAGAAGTCCATTTGACAGGGCCGCTGAG
TCCATCGCCACCAAAAGAACTGTTAGAAGAATCTGGACCGATGAGCCCTCCCAATGGTGCGCTGAGCCCGACGCTGCTGTTGCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNACCAAGGAACAGAGTGCTGTTGCTCTGTTGGCAGCGAAAATTCGGGGCTTCGAGACTCACTGCTGCGGCTGCTGCTTTTG
AAATGGGGATTCGCTTGGACGAAATGTCGGCAAATGTGAGGAAGAACGCCGGCATCGCAGCGCGCATCCTGTCCATCACAAGACAATTAGTACTCACCAC
TACAACTAAGCCACATGGATATGGAAATACCAGTCATTCTACGTACTTTTGGATCACTTGGTCGTAGGGTACACCCGCGACGTCGTCGCTGTTGACTTTG
CGCACGCGCAGGTTCTCGCGAATGAGCCGCGAGTAGTCGCCAATGCCTCGGCAGCGCGCGTTGTACTCGGCGGCGAG